Transcriptomic analyses and experimental verification reveal potential biomarkers and biological pathways of urinary tract infection.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34592898", "kind": "science-record", "revision": 6, "content_hash": "sha256:8ae93849551dfa25e3a759a25d409a6492214553dd0ceaa86d6c2df1d92ed02c", "created_at": "2026-11-01T15:41:54Z", "updated_at": "2026-11-01T22:04:51Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Transcriptomic analyses and experimental verification reveal potential biomarkers and biological pathways of urinary tract infection.", "doi": "10.1080/21655979.2021.1987081", "pmid": "34592898", "authors": ["Wenbo Yang", "Peng Liu", "Yuling Zheng", "Zhongtian Wang", "Wenhua Huang", "Hua Jiang", "Qingyu Lv", "Yuhao Ren", "Yongqiang Jiang", "Liping Sun"], "journal": "Bioengineered", "year": 2021, "abstract": "Urinary tract infection (UTI) is a common infectious disease. Urinary tract pathogenic Escherichia coli (UPEC) is the main cause of UTIs. At present, antibiotics are mainly used for the treatment of UTIs. However, with the increase of drug resistance, the course of the disease is prolonged. Therefore, identifying the receptors and signal pathways of host cells and tissues will further our understanding of the pathogenesis of UTIs and help in the development of new drug treatments. We used two public microarray datasets (GSE43790, GSE124917) in the Gene Expression Omnibus (GEO) database to identify differentially expressed genes (DEGs) between UTI and normal cell samples. A functional analysis based on Gene Ontology (GO) data, a pathway enrichment analysis based on Kyoto Encyclopedia of Genes and Genomes (KEGG) data and a protein-protein interaction analysis identified the main potential biomarkers and verified them in animal tissues. A total of 147 up-regulated genes and 40 down-regulated genes were identified. GO enrichment analysis showed that these functional changes relate to the terms response to lipopolysaccharide, regulation of cytokine production, and regulation of the inflammatory response. KEGG analysis indicated that urinary tract infections likely involve the TNF-αsignaling pathways. The 20 hub genes were selected from the protein-protein interaction network, and the highly significant hub genes were verified by animal experiments. Our findings provide potential targets for exploring new treatments for urinary tract infections. After a comprehensive analysis of the GEO database, these results may facilitate development of new diagnosis and treatment strategies for urinary tract infections.", "claims": [{"id": "claim-method", "statement": "The online difference analysis tool GEO2R [9] was used to find DEGs shared between the normal and UPEC-infected samples.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34592898", "locator": "sections[4] \"Identification of DEGs\" paragraph 2", "quote": "The online difference analysis tool GEO2R [9] was used to find DEGs shared between the normal and UPEC-infected samples."}], "state": "complete"}, {"id": "claim-data-access", "statement": "GSE43790 is derived from GPL6947 (Illumina HumanHT-12 V3.0 expression beadchip) and has three normal samples and five samples infected by UPEC [7].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34592898", "locator": "sections[3] \"Gene expression omnibus datasets\" paragraph 2", "quote": "GSE43790 is derived from GPL6947 (Illumina HumanHT-12 V3.0 expression beadchip) and has three normal samples and five samples infected by UPEC [7]."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34592898"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE124917"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE124917"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34592898", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1080/21655979.2021.1987081", "sha256": "sha256:260a897e2b426304a3b9ce862bcd219fc89db1f9ddfffdb6c8ae0c934108b2ee", "bytes": 22223, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1080/21655979.2021.1987081", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8806911", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE124917", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE124917", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE124917", "version": null, "note": "GSE43790 is derived from GPL6947 (Illumina HumanHT-12 V3.0 expression beadchip) and has three normal samples and five samples infected by UPEC [7].", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSE43790 is derived from GPL6947 (Illumina HumanHT-12 V3.0 expression beadchip) and has three normal samples and five samples infected by UPEC [7].", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM3559367", "GSM3559368", "GSM3559369", "GSM3559370", "GSM3559371", "GSM3559372"], "sample_count": 6, "group_sizes": null, "group_sizes_basis": null, "platform": "21185", "taxon": "Homo sapiens", "title": "Human renal fibroblasts are strong immunomobilizers during a urinary tract infection mediated by uropathogenic Escherichia coli", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE43790", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE43790", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE43790", "version": null, "note": "GSE43790 is derived from GPL6947 (Illumina HumanHT-12 V3.0 expression beadchip) and has three normal samples and five samples infected by UPEC [7].", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSE43790 is derived from GPL6947 (Illumina HumanHT-12 V3.0 expression beadchip) and has three normal samples and five samples infected by UPEC [7].", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1071306", "GSM1071307", "GSM1071308", "GSM1071309", "GSM1071310", "GSM1071311", "GSM1071312", "GSM1071313"], "sample_count": 8, "group_sizes": null, "group_sizes_basis": null, "platform": "6947", "taxon": "Homo sapiens", "title": "Expression data profile of A498 cells inoculated with E. coli 83972 and E. coli CFT073", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34592898:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:833222a07fc079687f34e868700a657d58054dab205318a2fd29cd4ef77f3fa2", "bytes": 1811, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#t0002", "version": null, "note": "GO and KEGG pathway enrichment analysis of the most important items in hub genes", "structure": {"pmcid": "PMC8806911", "section_index": 5, "section_title": "KEGG and GO enrichment analyses of DEGs", "row_count": 21, "column_count": 5}, "table": {"label": "Table 2.", "caption": "GO and KEGG pathway enrichment analysis of the most important items in hub genes", "rows": [["Category", "Pathway ID", "Pathway description", "Count", "P value"], ["GO-BP", "GO:0032496", "response to lipopolysaccharide", "29", "2.95121E-24"], ["GO-BP", "GO:0001817", "regulation of cytokine production", "31", "1.69824E-15"], ["GO-BP", "GO:0007159", "leukocyte cell-cell adhesion", "22", "5.24807E-15"], ["GO-BP", "GO:0031349", "positive regulation of defense response", "25", "1.99526E-14"], ["GO-BP", "GO:0050727", "regulation of inflammatory response", "24", "1.25893E-13"], ["GO-CC", "GO:0098552", "side of membrane", "17", "7.58578E-07"], ["GO-CC", "GO:0033256", "I-kappaB/NF-kappaB complex", "3", "1.12202E-06"], ["GO-CC", "GO:0048786", "presynaptic active zone", "5", "9.54993E-05"], ["GO-CC", "GO:0009898", "cytoplasmic side of plasma membrane", "6", "0.000870964"], ["GO-CC", "GO:0036464", "cytoplasmic ribonucleoprotein granule", "7", "0.001"], ["GO-MF", "GO:0005126", "cytokine receptor binding", "18", "3.01995E-13"], ["GO-MF", "GO:0051019", "mitogen-activated protein kinase binding", "5", "2.81838E-06"], ["GO-MF", "GO:0001228", "DNA-binding transcription activator activity,RNA polymerase II-specific", "13", "9.12011E-06"], ["GO-MF", "GO:0002020", "protease binding", "6", "0.000245471"], ["GO-MF", "GO:0001883", "purine nucleoside binding", "10", "0.00025704"], ["KEGG-PATHWAY", "hsa04668", "TNF signaling pathway", "28", "3.16228E-36"], ["KEGG-PATHWAY", "ko04621", "NOD-like receptor signaling pathway", "21", "8.51138E-21"], ["KEGG-PATHWAY", "ko04060", "Cytokine-cytokine receptor interaction", "21", "1.28825E-16"], ["KEGG-PATHWAY", "hsa05200", "Pathways in cancer", "24", "8.51138E-13"], ["KEGG-PATHWAY", "hsa04217", "necroptosis", "13", "1.04713E-10"]], "row_count": 21, "column_count": 5, "numeric_cells": 60, "header_rows": 1, "locator": "section[10]/table-wrap[1]#t0002"}}, {"id": "asset:table:pmid:34592898:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:4dafe01ed52fe741b11ef36fecbd67ed75cc38a8176be02e98d86a5bec0f6d43", "bytes": 432, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#t0001", "version": null, "note": "Primers used in this study", "structure": {"pmcid": "PMC8806911", "section_index": 7, "section_title": "Tissue specimens, Real Time-PCR, and ELISA analysis", "row_count": 5, "column_count": 3}, "table": {"label": "Table 1.", "caption": "Primers used in this study", "rows": [["Gene", "Forward Primer", "Reverse Primer"], ["TNF", "TCCAGGCGGTGCCTATGT", "GCCCCTGCCACAAGCA"], ["IL-6", "CCACGGCCTTCCCTACTTC", "TTGGGAGTGGTATCCTCTGTGA"], ["IL-1β", "AGTTGACGGACCCCAAAAGA", "GGACAGCCCAGGTCAAAGG"], ["GAPDH", "CATGGCCTTCCGTGTTCCTA", "GCGGCACGTCAGATCCA"]], "row_count": 5, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[7]/table-wrap[1]#t0001"}}, {"id": "asset:table:pmid:34592898:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:833222a07fc079687f34e868700a657d58054dab205318a2fd29cd4ef77f3fa2", "bytes": 1811, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#t0002", "version": null, "note": "GO and KEGG pathway enrichment analysis of the most important items in hub genes", "structure": {"pmcid": "PMC8806911", "section_index": 10, "section_title": "KEGG and GO enrichment analyses of DEGs", "row_count": 21, "column_count": 5}, "table": {"label": "Table 2.", "caption": "GO and KEGG pathway enrichment analysis of the most important items in hub genes", "rows": [["Category", "Pathway ID", "Pathway description", "Count", "P value"], ["GO-BP", "GO:0032496", "response to lipopolysaccharide", "29", "2.95121E-24"], ["GO-BP", "GO:0001817", "regulation of cytokine production", "31", "1.69824E-15"], ["GO-BP", "GO:0007159", "leukocyte cell-cell adhesion", "22", "5.24807E-15"], ["GO-BP", "GO:0031349", "positive regulation of defense response", "25", "1.99526E-14"], ["GO-BP", "GO:0050727", "regulation of inflammatory response", "24", "1.25893E-13"], ["GO-CC", "GO:0098552", "side of membrane", "17", "7.58578E-07"], ["GO-CC", "GO:0033256", "I-kappaB/NF-kappaB complex", "3", "1.12202E-06"], ["GO-CC", "GO:0048786", "presynaptic active zone", "5", "9.54993E-05"], ["GO-CC", "GO:0009898", "cytoplasmic side of plasma membrane", "6", "0.000870964"], ["GO-CC", "GO:0036464", "cytoplasmic ribonucleoprotein granule", "7", "0.001"], ["GO-MF", "GO:0005126", "cytokine receptor binding", "18", "3.01995E-13"], ["GO-MF", "GO:0051019", "mitogen-activated protein kinase binding", "5", "2.81838E-06"], ["GO-MF", "GO:0001228", "DNA-binding transcription activator activity,RNA polymerase II-specific", "13", "9.12011E-06"], ["GO-MF", "GO:0002020", "protease binding", "6", "0.000245471"], ["GO-MF", "GO:0001883", "purine nucleoside binding", "10", "0.00025704"], ["KEGG-PATHWAY", "hsa04668", "TNF signaling pathway", "28", "3.16228E-36"], ["KEGG-PATHWAY", "ko04621", "NOD-like receptor signaling pathway", "21", "8.51138E-21"], ["KEGG-PATHWAY", "ko04060", "Cytokine-cytokine receptor interaction", "21", "1.28825E-16"], ["KEGG-PATHWAY", "hsa05200", "Pathways in cancer", "24", "8.51138E-13"], ["KEGG-PATHWAY", "hsa04217", "necroptosis", "13", "1.04713E-10"]], "row_count": 21, "column_count": 5, "numeric_cells": 60, "header_rows": 1, "locator": "section[10]/table-wrap[1]#t0002"}}, {"id": "asset:table:pmid:34592898:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2e97e78327c10f6b1a55c1f6ee4f7804647e9a44f1af2c51d814f2f60aeae5fd", "bytes": 2095, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#t0003", "version": null, "note": "The most significant upregulated and downregulated genes in DEGs", "structure": {"pmcid": "PMC8806911", "section_index": 11, "section_title": "PPI network construction and hub gene identification", "row_count": 22, "column_count": 7}, "table": {"label": "Table 3.", "caption": "The most significant upregulated and downregulated genes in DEGs", "rows": [["Gene symbol", "Gene description", "logFC", "P value", "Regulation"], ["", "", "GSE43790", "GSE124917", "GSE43790", "GSE124917", ""], ["CXCL8", "Interleukin-8", "4.37", "5.37", "2.63E-09", "9.54E-08", "Upregulated"], ["RELA", "Transcription factor p65", "1.27", "2.25", "7.33E-04", "7.27E-06", "Upregulated"], ["CXCL1", "Growth-regulated alpha protein", "4.88", "5.73", "1.85E-07", "5.73E-05", "Upregulated"], ["TNF", "Tumor necrosis factor", "3.34", "4.56", "2.20E-06", "1.37E-02", "Upregulated"], ["NFKB1", "Nuclear factor NF-kappa-B p105 subunit", "1.53", "2.01", "4.27E-04", "8.94E-06", "Upregulated"], ["CXCL2", "C-X-C motif chemokine 2", "3.76", "5.98", "7.24E-08", "2.01E-06", "Upregulated"], ["C3", "Complement C3", "1.18", "4.30", "8.46E-03", "1.45E-04", "Upregulated"], ["SAA1", "Serum amyloid A-1 protein", "1.07", "4.13", "4.91E-03", "3.86E-02", "Upregulated"], ["CCL5", "C-C motif chemokine 5", "1.39", "10.65", "1.60E-02", "8.65E-07", "Upregulated"], ["CXCL10", "C-X-C motif chemokine 10", "3.66", "14.04", "7.13E-06", "1.58E-08", "Upregulated"], ["IL6", "Interleukin-6", "4.01", "3.79", "6.15E-08", "3.07E-05", "Upregulated"], ["CCL20", "C-C motif chemokine 20", "5.61", "7.37", "1.99E-07", "4.61E-05", "Upregulated"], ["IL1B", "Interleukin-1 beta", "2.87", "6.27", "1.19E-04", "2.93E-04", "Upregulated"], ["BDKRB2", "B2 bradykinin receptor", "1.93", "1.43", "1.47E-05", "3.41E-02", "Upregulated"], ["GPER1", "G-protein coupled estrogen receptor 1", "−1.62", "−1.41", "1.12E-02", "3.57E-04", "Downregulated"], ["S1PR5", "Sphingosine 1-phosphate receptor 5", "−1.78", "−1.98", "6.58E-04", "3.26E-02", "Downregulated"], ["BDKRB1", "B1 bradykinin receptor", "3.09", "3.53", "1.45E-05", "2.35E-05", "Upregulated"], ["CX3CL1", "Fractalkine", "3.63", "6.18", "2.39E-05", "2.34E-06", "Upregulated"], ["BIRC3", "Baculoviral IAP repeat-containing protein 3", "3.04", "5.29", "3.96E-09", "5.30E-06", "Upregulated"], ["ADORA1", "Adenosine receptor A1", "−1.02", "−1.06", "9.53E-03", "1.13E-02", "Downregulated"]], "row_count": 22, "column_count": 7, "numeric_cells": 99, "header_rows": 2, "locator": "section[11]/table-wrap[1]#t0003"}}], "gaps": ["asset:data:geo:GSE124917 not downloaded", "asset:data:geo:GSE124917 licence not read", "asset:data:geo:GSE43790 not downloaded", "asset:data:geo:GSE43790 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}, {"id": "method-3", "family": null, "specific": null, "label": "GEO2R", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The online difference analysis tool GEO2R [9] was used to find DEGs shared between the normal and UPEC-infected samples."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE43790", "GSE124917"], "resolved_accessions": ["GSE43790", "GSE124917"], "statements": ["GSE43790 is derived from GPL6947 (Illumina HumanHT-12 V3.0 expression beadchip) and has three normal samples and five samples infected by UPEC [7]."], "basis": "The paper names GSE43790, GSE124917 in NCBI Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:34592898", "data:geo:GSE124917", "asset:table:pmid:34592898:1", "asset:table:pmid:34592898:2", "asset:table:pmid:34592898:3", "asset:table:pmid:34592898:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE124917"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:50:54Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 12155, "completion_tokens": 1144, "cached_tokens": 528}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34592898", "type": "paper", "label": "pmid:34592898"}, {"id": "source:pmid:34592898", "type": "manuscript", "label": "PMID 34592898 full text"}, {"id": "data:geo:GSE124917", "type": "dataset", "label": "GEO GSE124917"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34592898", "type": "paper", "label": "pmid:34592898"}, {"id": "source:pmid:34592898", "type": "manuscript", "label": "PMID 34592898 full text"}, {"id": "data:geo:GSE124917", "type": "dataset", "label": "GEO GSE124917"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34592898", "type": "extraction", "used": ["source:pmid:34592898"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE124917", "type": "accession_resolution", "used": ["data:geo:GSE124917"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34592898", "parent_hash": "sha256:308fca4ae4f36a1a5467feeeec737504d9d83331876e7dd55762c6067e5f3adf", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:GSE124917 licence not read", "asset:data:geo:GSE124917 not downloaded", "asset:data:geo:GSE43790 licence not read", "asset:data:geo:GSE43790 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["t of new drug treatments. We used two public microarray datasets (GSE43790, GSE124917) in the Gene E"], "order_basis": "paper_text_order:594", "id": "assay:1"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}