Circular RNA 0006349 Augments Glycolysis and Malignance of Non-small Cell Lung Cancer Cells Through the microRNA-98/MKP1 Axis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34604211", "kind": "science-record", "revision": 8, "content_hash": "sha256:7d7fc500ddf4d077f6dba762298d6539cf347cc0c776425d2dff074c3d6fbc21", "created_at": "2026-11-01T15:41:55Z", "updated_at": "2026-11-01T22:47:39Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Circular RNA 0006349 Augments Glycolysis and Malignance of Non-small Cell Lung Cancer Cells Through the microRNA-98/MKP1 Axis.", "doi": "10.3389/fcell.2021.690307", "pmid": "34604211", "authors": ["Chu Qin", "Rongguo Lu", "Minyu Yuan", "Rui Zhao", "Huiya Zhou", "Xiaodong Fan", "Bo Yin", "Haoda Yu", "Tao Bian"], "journal": "Frontiers in cell and developmental biology", "year": 2021, "abstract": "Background: The involvement of dysregulated circular RNAs (circRNAs) in human diseases has been increasingly recognized. In this study, we focused on the function of a newly screened circRNA, circ_0006349, in the progression of non-small-cell lung cancer (NSCLC) and the molecules of action. Methods: The NSCLC circRNA dataset GSE101684, microRNA (miRNA) dataset GSE29250, and mRNA dataset GSE51852 obtained from the GEO database were used to identify the differentially expressed genes in NSCLC samples. Tumor and normal tissues were collected from 59 patients with NSCLC. The expression of circ_0006349, miR-98, and MAP kinase phosphatase 1 (MKP1) in collected tissue samples and in acquired cells was determined. The binding relationships between miR-98 and circ_0006349/MKP1 were predicted and validated. Altered expression of circ_0006349, miR-98, and MKP1 was introduced in NSCLC cells to examine their roles in cell growth, apoptosis, and glycolysis. Results: Circ_0006349 and MKP1 were upregulated, and miR-98 was poorly expressed in the collected tumor tissues and the acquired NSCLC cell lines. Circ_0006349 was identified as a sponge for miR-98 to elevate MKP1 expression. Silencing of circ_0006349 suppressed proliferation and increased apoptosis of Calu-3 and H1299 cells, and it reduced glycolysis, glucose uptake, and the production of lactate in cells. Upon circ_0006349 knockdown, further downregulation of miR-98 or upregulation of MKP1 restored the malignant behaviors of cells. Conclusion: This research demonstrated that circ_0006349 derepressed MKP1 expression by absorbing miR-98, which augmented the proliferation and glycolysis of NSCLC cells and promoted cancer development.", "claims": [{"id": "claim-method", "statement": "Using the Limma R Package, a total of 415 differentially expressed circRNAs were screened in the settings of |Log FC| > 1 and adjusted p value < 0.05 (Figure 1A).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34604211", "locator": "sections[20] \"Circ_0006349 Is Highly Expressed and Indicates Dismal Prognosis in Patients With NSCLC\" paragraph 2", "quote": "Using the Limma R Package, a total of 415 differentially expressed circRNAs were screened in the settings of |Log FC| > 1 and adjusted p value < 0.05 (Figure 1A)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34604211"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_absent"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34604211", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fcell.2021.690307", "sha256": "sha256:9633fcf4c4bf639ebbabbf7857bf2fa665009519738622afab8a78f1b262a574", "bytes": 47348, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fcell.2021.690307", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8484757", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "asset:table:pmid:34604211:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:51075f6dbe7f029acb9e38ce7e0963872003bf851717534a30b32ee4636575f7", "bytes": 554, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#T1", "version": null, "note": "Primer sequences for RT-qPCR.", "structure": {"pmcid": "PMC8484757", "section_index": 5, "section_title": "Reverse Transcription Quantitative Polymerase Chain Reaction", "row_count": 11, "column_count": 2}, "table": {"label": "TABLE 1", "caption": "Primer sequences for RT-qPCR.", "rows": [["Gene", "Primer sequence (5′-3′)"], ["Circ_0006349", "F: TTTGGGATGTACATTCCGTT"], ["", "R: TCCCACTTCCGCTTCCA"], ["MKP1", "F: CAACCACAAGGCAGACATCAGC"], ["", "R: GTAAGCAAGGCAGATGGTGGCT"], ["miR-98", "F: GAGGTAGTAAGTTGTATTG"], ["", "R: GAACATGTCTGCGTATCTC"], ["U6", "F: CTCGCTTCGGCAGCACAT"], ["", "R: TTTGCGTGTCATCCTTGCG"], ["GAPDH", "F: GTCTCCTCTGACTTCAACAGCG"], ["", "R: ACCACCCTGTTGCTGTAGCCAA"]], "row_count": 11, "column_count": 2, "numeric_cells": 3, "header_rows": 1, "locator": "section[5]/table-wrap[1]#T1"}}], "gaps": []}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Using the Limma R Package, a total of 415 differentially expressed circRNAs were screened in the settings of |Log FC| > 1 and adjusted p value < 0.05 (Figure 1A)."}}, {"id": "method-2", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": [], "resolved_accessions": [], "statements": [], "basis": "The paper names no accession to its source data, so the data has to come from the authors."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:34604211", "asset:table:pmid:34604211:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:None"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:51:17Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 13151, "completion_tokens": 277, "cached_tokens": 264}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34604211", "type": "paper", "label": "pmid:34604211"}, {"id": "source:pmid:34604211", "type": "manuscript", "label": "PMID 34604211 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34604211", "type": "paper", "label": "pmid:34604211"}, {"id": "source:pmid:34604211", "type": "manuscript", "label": "PMID 34604211 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34604211", "type": "extraction", "used": ["source:pmid:34604211"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-None", "type": "accession_resolution", "used": ["data:geo:None"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34604211", "parent_hash": "sha256:0952f0aa90f6580e9bd50be75f4b775324de8d55e697e58bfb312a1461a59f63", "fork_of": null, "generation": 7}, "gaps": ["execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_absent"], "assays": [{"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["cells to examine their roles in cell growth, apoptosis, and glycolysis. Results: Circ_0006349 and M", "06349 suppressed proliferation and increased apoptosis of Calu-3 and H1299 cells, and it reduced gl"], "order_basis": "paper_text_order:1013", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ction of lactate in cells. Upon circ_0006349 knockdown, further downregulation of miR-98 or upregul", "ined from each participant. Cell Culture and Transfection The human bronchial epithelial cell line BEA", "ent experiments, Calu-3 and H1299 cells were transfected with small interfering RNAs (siRNAs) targeti", "or overexpression vector of MKP1 (oe-MKP1). Transfection was performed using Lipofectamine 2000 reage"], "order_basis": "paper_text_order:1469", "id": "assay:2"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ences (Shanghai, China). HEK-293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gi", "ial cell line BEAS-2B, six NSCLC cell lines (A549, H1299, Calu-3, H520, H1650, and H1730), and", "349 expression in acquired NSCLC cell lines (A549, H1299, Calu-3, H520, H1650, and H1730) and", "H) circ_0006349 expression NSCLC cell lines (A549, H1299, Calu-3, H520, H1650, and H1730) and"], "order_basis": "paper_text_order:2580", "id": "assay:3"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["d normal tissues from 59 NSCLC patients. The RT-qPCR results suggested that circ_0006349 expressi", "tion quantitative polymerase chain reaction (RT-qPCR); (D–G) relevance between circ_0006349 expre", "and H1730) and in BEAS-2B cells detected by RT-qPCR. Differences were compared by paired t test", "The transfection efficacy was examined by RT–qPCR 48 h later. Statistical Analysis All data ar"], "order_basis": "paper_text_order:3445", "id": "assay:4"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Using the Limma R Package, a total of 415 differentially expressed circRNAs were screened in the settings of |Log FC| > 1 and adjusted p value < 0.05 (Figure 1A)."], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}