Ribo-Seq and RNA-Seq of TMA46 ( DFRP1) and GIR2 ( DFRP2) knockout yeast strains.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34900236", "kind": "science-record", "revision": 5, "content_hash": "sha256:5ff79cd8664ba7e69708e14422e00212a6b17aca9b4f00589c6f8ebceca06d6f", "created_at": "2026-11-01T17:36:37Z", "updated_at": "2026-11-01T22:48:03Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Ribo-Seq and RNA-Seq of TMA46 ( DFRP1) and GIR2 ( DFRP2) knockout yeast strains.", "doi": "10.12688/f1000research.74727.1", "pmid": "34900236", "authors": ["Artyom A Egorov", "Desislava S Makeeva", "Nadezhda E Makarova", "Dmitri A Bykov", "Yanislav S Hrytseniuk", "Olga V Mitkevich", "Valery N Urakov", "Alexander I Alexandrov", "Ivan V Kulakovskiy", "Sergey E Dmitriev"], "journal": "F1000Research", "year": 2021, "abstract": "In eukaryotes, stalled and collided ribosomes are recognized by several conserved multicomponent systems, which either block protein synthesis in situ and resolve the collision locally, or trigger a general stress response. Yeast ribosome-binding GTPases RBG1 (DRG1 in mammals) and RBG2 (DRG2) form two distinct heterodimers with TMA46 (DFRP1) and GIR2 (DFRP2), respectively, both involved in mRNA translation. Accumulated evidence suggests that the dimers play partially redundant roles in elongation processivity and resolution of ribosome stalling and collision events, as well as in the regulation of GCN1-mediated signaling involved in ribosome-associated quality control (RQC). They also genetically interact with SLH1 (ASCC3) helicase, a key component of RQC trigger (RQT) complex disassembling collided ribosomes. Here, we present RNA-Seq and ribosome profiling (Ribo-Seq) data from S. cerevisiae strains with individual deletions of the TMA46 and GIR2 genes. Raw RNA-Seq and Ribo-Seq data as well as gene-level read counts are available in NCBI Gene Expression Omnibus (GEO) repository under GEO accession GSE185458 and GSE185286.", "claims": [{"id": "claim-method", "statement": "A generalized linear model (glmQLFit, glmQLFTest of the edgeR package) was used to detect differentially expressed genes (for RNA-Seq, Ribo-Seq, and ribosome occupancy (RO) defined as the Ribo-Seq coverage of a CDS normalized to its RNA-Seq coverage) with the strain as a categorical variable.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34900236", "locator": "sections[5] \"Differential expression and Gene Ontology (GO) enrichment analysis\" paragraph 2", "quote": "A generalized linear model (glmQLFit, glmQLFTest of the edgeR package) was used to detect differentially expressed genes (for RNA-Seq, Ribo-Seq, and ribosome occupancy (RO) defined as the Ribo-Seq coverage of a CDS normalized to its RNA-Seq coverage) with the strain as a categorical variable."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Raw RNA-Seq and Ribo-Seq data as well as gene-level read counts are available in NCBI Gene Expression Omnibus (GEO) repository under GEO accession GSE185458 and GSE185286.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34900236", "locator": "sections[0] \"Abstract\" paragraph 1", "quote": "Raw RNA-Seq and Ribo-Seq data as well as gene-level read counts are available in NCBI Gene Expression Omnibus (GEO) repository under GEO accession GSE185458 and GSE185286."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": "", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34900236"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE185286"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE185286"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34900236", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.12688/f1000research.74727.1", "sha256": "sha256:64b44da4dcd56f8da607dfb4127d44b880eeff7e8f0e339de34fe2bd08c1f2d1", "bytes": 18879, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.12688/f1000research.74727.1", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8637242", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE185286", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE185286", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE185286", "version": null, "note": "Raw RNA-Seq and Ribo-Seq data as well as gene-level read counts are available in NCBI Gene Expression Omnibus (GEO) repository under GEO accession GSE185458 and GSE185286.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Raw RNA-Seq and Ribo-Seq data as well as gene-level read counts are available in NCBI Gene Expression Omnibus (GEO) repository under GEO accession GSE185458 and GSE185286.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM5610123", "GSM5610124", "GSM5610125", "GSM5610126", "GSM5610127", "GSM5610128", "GSM5610129", "GSM5610130", "GSM5610131", "GSM5610132", "GSM5610133", "GSM5610134", "GSM5610135", "GSM5610136", "GSM5610137", "GSM5610138", "GSM5610139", "GSM5610140", "GSM5610141", "GSM5610142", "GSM5610143", "GSM5610144", "GSM5610145", "GSM5610146", "GSM5610147", "GSM5610148"], "sample_count": 26, "group_sizes": null, "group_sizes_basis": null, "platform": "26302", "taxon": "Saccharomyces cerevisiae", "title": "RNA Sequencing and Ribosome profiling of GIR2 and PUB1 knockout yeast strains.", "resolution_checked_at": "2026-11-01T17:30:42Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE185458", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE185458", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE185458", "version": null, "note": "Raw RNA-Seq and Ribo-Seq data as well as gene-level read counts are available in NCBI Gene Expression Omnibus (GEO) repository under GEO accession GSE185458 and GSE185286.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Raw RNA-Seq and Ribo-Seq data as well as gene-level read counts are available in NCBI Gene Expression Omnibus (GEO) repository under GEO accession GSE185458 and GSE185286.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM5615626", "GSM5615627", "GSM5615628", "GSM5615629", "GSM5615630", "GSM5615631", "GSM5615632", "GSM5615633", "GSM5615634", "GSM5615635", "GSM5615636", "GSM5615637", "GSM5615638", "GSM5615639", "GSM5615640", "GSM5615641", "GSM5615642", "GSM5615643", "GSM5615644", "GSM5615645", "GSM5615646", "GSM5615647", "GSM5615648", "GSM5615649", "GSM5615650", "GSM5615651", "GSM5615652", "GSM5615653", "GSM5615654", "GSM5615655", "GSM5615656", "GSM5615657"], "sample_count": 32, "group_sizes": null, "group_sizes_basis": null, "platform": "19756", "taxon": "Saccharomyces cerevisiae", "title": "RNA Sequencing and Ribosome profiling of TMA46, STM1 and YGR054W knockout yeast strains", "resolution_checked_at": "2026-11-01T17:30:42Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}], "gaps": ["asset:data:geo:GSE185286 not downloaded", "asset:data:geo:GSE185286 licence not read", "asset:data:geo:GSE185458 not downloaded", "asset:data:geo:GSE185458 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "edger", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "A generalized linear model (glmQLFit, glmQLFTest of the edgeR package) was used to detect differentially expressed genes (for RNA-Seq, Ribo-Seq, and ribosome occupancy (RO) defined as the Ribo-Seq coverage of a CDS normalized to its RNA-Seq coverage) with the strain as a categorical variable."}}, {"id": "method-2", "family": "sequence_alignment", "specific": "read_mapping", "label": "Sequence alignment / homology", "dsl_operations": ["sequence_align", "alignment_identity"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["sequence_records"], "evidence": {"score": 0.8, "band": "high", "quote": "Read mapping"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: edger."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE185458", "GSE185286"], "resolved_accessions": ["GSE185458", "GSE185286"], "statements": ["Raw RNA-Seq and Ribo-Seq data as well as gene-level read counts are available in NCBI Gene Expression Omnibus (GEO) repository under GEO accession GSE185458 and GSE185286."], "basis": "The paper names GSE185458, GSE185286 in NCBI Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:34900236", "data:geo:GSE185286"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE185286"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-11-01T17:11:19Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 5, "usage": {"prompt_tokens": 7180, "completion_tokens": 2623, "cached_tokens": 128}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34900236", "type": "paper", "label": "pmid:34900236"}, {"id": "source:pmid:34900236", "type": "manuscript", "label": "PMID 34900236 full text"}, {"id": "data:geo:GSE185286", "type": "dataset", "label": "GEO GSE185286"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34900236", "type": "paper", "label": "pmid:34900236"}, {"id": "source:pmid:34900236", "type": "manuscript", "label": "PMID 34900236 full text"}, {"id": "data:geo:GSE185286", "type": "dataset", "label": "GEO GSE185286"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34900236", "type": "extraction", "used": ["source:pmid:34900236"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE185286", "type": "accession_resolution", "used": ["data:geo:GSE185286"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34900236", "parent_hash": "sha256:aa88ac1710f199b9501318e7c56bfbf049f6b0ec6ffbde0214d21cf98b803754", "fork_of": null, "generation": 4}, "gaps": ["asset:data:geo:GSE185286 licence not read", "asset:data:geo:GSE185286 not downloaded", "asset:data:geo:GSE185458 licence not read", "asset:data:geo:GSE185458 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["Ribo-Seq and RNA-Seq of TMA46 ( DFRP1) and GIR2 ( DFRP2) knockout", "embling collided ribosomes. Here, we present RNA-Seq and ribosome profiling (Ribo-Seq) data from", "l deletions of the TMA46 and GIR2 genes. Raw RNA-Seq and Ribo-Seq data as well as gene-level read", "v. 2.10 16 with the following parameters for RNA-Seq (-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC –mini"], "order_basis": "paper_text_order:0", "id": "assay:1"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["A generalized linear model (glmQLFit, glmQLFTest of the edgeR package) was used to detect differentially expressed genes (for RNA-Seq, Ribo-Seq, and ribosome occupancy (RO) defined as the Ribo-Seq coverage of a CDS normalized to its RNA-Seq coverage) with the strain as a categorical variable."], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}