Identification and validation of the important role of KIF11 in the development and progression of endometrial cancer.

{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:39806429", "kind": "science-record", "revision": 2, "content_hash": "sha256:1d16c133ac5036897ecd71e03bbcff0a9d678614c90bea5a3c99aaad7983f341", "created_at": "2026-11-01T10:25:49Z", "updated_at": "2026-11-01T14:01:33Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "Identification and validation of the important role of KIF11 in the development and progression of endometrial cancer.", "doi": "10.1186/s12967-025-06081-6", "pmid": "39806429", "authors": null, "journal": "Journal of translational medicine", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:39806429"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:39806429", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:39806429' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:39806429", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12967-025-06081-6", "sha256": "sha256:a3b65116256b975fdce201335e477f9a25b8f658e150f079687eded3bd1b8dd7", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12967-025-06081-6", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:39806429:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d640fead1cb136dde2afe2c9ca9bf96c948ea4ad80609e63abaf771c7def027c", "bytes": 408, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#Tab1", "version": null, "note": "Primers used in this study", "structure": {"pmcid": "PMC11727483", "section_index": 12, "section_title": "RNA isolation and real-time fluorescent quantitative PCR (RT‒qPCR)", "row_count": 5, "column_count": 4}, "table": {"label": "Table 1", "caption": "Primers used in this study", "rows": [["Gene", "Primer", "Sequence (5’-3’)", "PCR Products"], ["β-actin", "Forward", "CCCTGGAGAAGAGCTACGAG", "180 bp"], ["Reverse", "CGTACAGGTCTTTGCGGATG"], ["KIF11", "Forward", "CCGTAACAAGAGAGGAGTGA", "155 bp"], ["Reverse", "AGAAAACTGAGTGGGAACGA"]], "row_count": 5, "column_count": 4, "numeric_cells": 4, "header_rows": 1, "locator": "section[12]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:39806429:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:188d5ab369b5dbff237498cd08e0ddf0c1dc2960b10facd4fb6a45c031651450", "bytes": 1086, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[1]#Tab2", "version": null, "note": "Information on the 25 genes screened through MCODE. KIF11 is marked in bold", "structure": {"pmcid": "PMC11727483", "section_index": 23, "section_title": "PPI network analysis of DEGs", "row_count": 26, "column_count": 4}, "table": {"label": "Table 2", "caption": "Information on the 25 genes screened through MCODE. KIF11 is marked in bold", "rows": [["Gene symbol", "Degree", "LogFC", "P value"], ["CDK1", "48", "1.33", "2.68E-07"], ["BUB1B", "44", "1.77", "1.17E-06"], ["KIF11", "43", "2.52", "1.96E-08"], ["CCNB1", "41", "2.11", "2.98E-06"], ["KIF20A", "40", "2.21", "1.20E-10"], ["DLGAP5", "39", "2.92", "1.42E-09"], ["TOP2A", "38", "2.35", "2.23E-12"], ["TPX2", "35", "1.80", "4.47E-07"], ["ASPM", "35", "1.94", "5.19E-08"], ["KIF2C", "35", "1.22", "7.20E-07"], ["CENPF", "35", "1.81", "5.91E-11"], ["NUSAP1", "34", "1.84", "1.82E-08"], ["BIRC5", "34", "1.00", "5.26E-06"], ["CEP55", "32", "3.21", "3.23E-10"], ["KIF4A", "31", "1.77", "1.68E-07"], ["MELK", "30", "3.31", "1.86E-13"], ["UBE2C", "30", "1.95", "6.87E-11"], ["NUF2", "29", "2.20", "7.35E-07"], ["NCAPG", "28", "1.85", "3.46E-08"], ["TTK", "28", "2.29", "4.03E-08"], ["PBK", "24", "2.32", "2.78E-06"], ["KIF23", "23", "1.33", "1.07E-05"], ["CDC20", "23", "1.11", "3.59E-11"], ["RRM2", "20", "3.37", "2.82E-12"], ["NEK2", "20", "1.59", "4.32E-10"]], "row_count": 26, "column_count": 4, "numeric_cells": 80, "header_rows": 1, "locator": "section[23]/table-wrap[1]#Tab2"}}], "gaps": ["asset:source:pmid:39806429 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:39806429", "asset:table:pmid:39806429:1", "asset:table:pmid:39806429:2"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:39806429"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "full-text-reading-v1", "prompt_hash": "fb413bce127dbc012118f6a6116bea5d3a955fd0c5bf226ec9b2e012aeab13aa", "source_hash": "a3b65116256b975fdce201335e477f9a25b8f658e150f079687eded3bd1b8dd7", "raw_response_sha256": "sha256:7849f723d0e8b80e181a6becd42f2817269f3043b40436f31a822a3d8e64b3ec", "raw_response_chars": 3534}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "full-text-reading-v1", "prompt_hash": "11d642b51456ccf0378392611100afc861bd9d265c9abf8f036566cfb0257274", "source_hash": "a3b65116256b975fdce201335e477f9a25b8f658e150f079687eded3bd1b8dd7", "raw_response_sha256": "sha256:16a5998c9a5bb50e934fee0628fb8f57f230dd40ec2456810371594a90d115f7", "raw_response_chars": 39724}], "target_providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "replication-target-v2", "prompt_hash": "f1a3de24c6ba6fea48812ef6aee8743dc6553daec06f432ffcdfc878af63b688", "source_hash": "a3b65116256b975fdce201335e477f9a25b8f658e150f079687eded3bd1b8dd7", "raw_response": "{\"parent_value\":0,\"unit\":\"\",\"evidence\":\"\",\"target_result\":\"The paper states that KIF11 was upregulated in endometrial cancer, closely associated with a poor prognosis, and that KIF11 knockdown inhibited EC cell proliferation, migration and invasion, caused G2/M phase arrest, and promoted apoptosis; it does not state a numerical result for this main finding.\",\"number_stated\":false}", "reading": {"parent_value": 0, "unit": "", "evidence": "", "target_result": "The paper states that KIF11 was upregulated in endometrial cancer, closely associated with a poor prognosis, and that KIF11 knockdown inhibited EC cell proliferation, migration and invasion, caused G2/M phase arrest, and promoted apoptosis; it does not state a numerical result for this main finding.", "number_stated": false, "source_locator": null}, "recorded_at": "2026-10-31T15:20:02.032038+00:00"}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "replication-target-v2", "prompt_hash": "94b7a2bbe18cd2b7ee347d855e6bb59560dc266cd3c42878f666f3f2f6a1b248", "source_hash": "a3b65116256b975fdce201335e477f9a25b8f658e150f079687eded3bd1b8dd7", "raw_response": "<think>We need answer JSON only. Need identify single numerical result headline for registered target: \"headline numerical result paper states for its main finding\". Source supplied excerpt has several numbers. Need interpret target generic. Paper main finding KIF11 role, likely headline numerical result perhaps 877 DEGs? But registered target wording likely asks headline numerical result paper states for main finding. Need determine from source text. Explicit Results opening: \"A total of 877 DEGs...\" This is a headline numerical result. Other numbers: 162 nodes, 756 interactions, 25 genes, versions, thresholds. Main finding perhaps total 877 DEGs. They ask \"single numerical result that a replication of the registered target has to reproduce. ... value the paper itself states for the registered target\". Registered target is \"the headline numerical result the paper states for its main finding.\" We need find likely 877 DEGs, unit maybe \"DEGs\" (count). Evidence exact contiguous quotation containing number and attribution. Quote whole clause: \"A total of 877 DEGs, which are widely involved in important biological processes such as cell division, tubulin binding, and the cell cycle, were identified.\" Parent_value 877, unit likely \"DEGs\" as printed. target_result could state same. number_stated true.\n\nNeed ensure evidence exact contiguous quote. Yes. Unit must unit paper prints. It prints \"DEGs\". Could unit be \"DEGs\" or perhaps no conventional unit, \"DEGs\" entity count. The requested headline number only perhaps target_result should be \"877 DEGs\". JSON. No markdown. Need exact quote. Ensure punctuation exact. Source has that exact sentence in abstract and result. Quote full clause. target_result perhaps \"877 DEGs\". Let's formulate valid JSON.</think>\n\n{\"parent_value\":877,\"unit\":\"DEGs\",\"evidence\":\"A total of 877 DEGs, which are widely involved in important biological processes such as cell division, tubulin binding, and the cell cycle, were identified.\",\"target_result\":\"877 DEGs\",\"number_stated\":true}", "reading": {"parent_value": 877, "unit": "DEGs", "evidence": "A total of 877 DEGs, which are widely involved in important biological processes such as cell division, tubulin binding, and the cell cycle, were identified.", "target_result": "877 DEGs", "number_stated": true, "source_locator": "chars 1304-1461 of source sha256 a3b65116256b975fdce201335e477f9a25b8f658e150f079687eded3bd1b8dd7"}, "recorded_at": "2026-10-31T15:20:03.216611+00:00"}], "agreement": false, "disagreements": {"target_result": {"minimax": "A total of 877 DEGs were identified in endometrial cancer.", "minimax_alt": "A total of 877 DEGs, which are widely involved in important biological processes such as cell division, tubulin binding, and the cell cycle, were identified.", "decisive": false}, "physical_methods": {"minimax": ["Expression of KIF11 was validated in clinical samples.", "In vitro experiments evaluated the effects of KIF11 on proliferation, migration, invasion, apoptosis, and cell-cycle arrest in endometrial cancer cells.", "Flow cytometry analysis assessed G2/M phase arrest and apoptosis after KIF11 knockdown."], "minimax_alt": ["Clinical-sample validation of KIF11 expression", "In vitro KIF11 knockdown experiments in endometrial cancer cells", "In vitro evaluation of proliferation, migration, invasion, apoptosis, and cell cycle", "Flow cytometry analysis of cell-cycle arrest and apoptosis"], "decisive": false}, "analysis_methods": {"minimax": ["limma", "Gene Ontology enrichment analysis", "KEGG pathway enrichment analysis", "protein–protein interaction network analysis", "machine learning", "STRING", "MCODE", "Kaplan–Meier survival analysis", "log-rank test"], "minimax_alt": ["limma differential-expression analysis", "Gene Ontology (GO) enrichment analysis", "Kyoto Encyclopedia of Genes and Globes (KEGG) pathway analysis via clusterProfiler", "STRING protein–protein interaction (PPI) network construction", "MCODE hub-cluster analysis", "Machine learning for hub-gene screening; algorithm not specified", "TCGA clinical and survival analysis", "Optimal cutoff selection using the Surv_cutpoint function in survminer", "Kaplan‒Meier survival analysis using the survival package in R", "Two-group t tests", "Kruskal–Wallis test and Wilcoxon test", "Log-rank test"], "decisive": false}, "statistical_method": {"minimax": "limma", "minimax_alt": "limma package", "decisive": true}, "number_stated": {"minimax": false, "minimax_alt": true, "decisive": true}}, "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": []}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:ed7461aeb6bfc9c8de348b954cf2a543ae03d085ea847c3442b6c784d6597fc9", "type": "sep_package", "label": "SEP v1 package for pmid:39806429"}], "activities": [{"id": "activity:conversion:pmid:39806429", "type": "conversion", "used": ["package:ed7461aeb6bfc9c8de348b954cf2a543ae03d085ea847c3442b6c784d6597fc9"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:minimax", "type": "model", "label": "minimax"}, {"id": "agent:minimax_alt", "type": "model", "label": "minimax_alt"}, {"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:39806429", "parent_hash": "sha256:d7fa7c470295e62d0a7d954feb39304fdb234c5d7fdcd3b800ed47bdbc35fbf4", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:39806429 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:39806429' does not resolve to a declared asset", "targets"]}