CUL1-neddylation contributes to K29-linked ubiquitination on p27 for autophagic degradation in sorafenib-resistant liver cancer.

{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:40111576", "kind": "science-record", "revision": 2, "content_hash": "sha256:e82399ec580d65e478e52fda2a69a439840ca6a9cf31dfd75245c7428392adc6", "created_at": "2026-11-01T10:25:50Z", "updated_at": "2026-11-01T14:01:38Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "CUL1-neddylation contributes to K29-linked ubiquitination on p27 for autophagic degradation in sorafenib-resistant liver cancer.", "doi": "10.1007/s10565-025-10008-8", "pmid": "40111576", "authors": null, "journal": "Cell biology and toxicology", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:40111576"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:40111576", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40111576' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:40111576", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1007/s10565-025-10008-8", "sha256": "sha256:62e5140fdfff5ae5f950ae8d1a51bb28f1b1317e283f6ad96e6e401f15e97d25", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1007/s10565-025-10008-8", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:40111576:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:1ca3e4f3024cdfa733fb8797612fbf73495c717a2c2547d70aa98922ba774f6b", "bytes": 722, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#Tab1", "version": null, "note": "List of antibodies used", "structure": {"pmcid": "PMC11926008", "section_index": 5, "section_title": "Western blot", "row_count": 12, "column_count": 4}, "table": {"label": "Table 1", "caption": "List of antibodies used", "rows": [["Primary antibodies", "MW (kDa)", "Dilution", "Source/ Catalog Number"], ["CUL1", "90/82", "1:400", "Thermo Fisher, 71–8700"], ["NEDD8", "9/90", "1:1000", "Abcam, ab81264"], ["p21", "21", "1:500", "Ptgcn, 10355–1-AP"], ["p27", "27", "1:1000", "Abcam, ab32034"], ["LC3B", "18/16", "1:2000", "Abcam, ab51520"], ["Skp2", "48", "1:1000", "CST, 2652"], ["SQSTM1", "62", "1:1000", "Ptgcn, 18420–1-AP"], ["NBR1", "37", "1:500", "Abcam, ab55474"], ["OPTN", "66", "1:2000", "Ptgcn, 10837–1-AP"], ["NDP52", "52", "1:500", "Ptgcn, 12229–1-AP"], ["β-actin", "42", "1:2000", "Ptgcn, 66009- 1-Ig"]], "row_count": 12, "column_count": 4, "numeric_cells": 36, "header_rows": 1, "locator": "section[5]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:40111576:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:739eefa62bb467ac13ae29fbbf59b1ae5e9a1a86bbb3ca2f24d0fc9e198659ca", "bytes": 640, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[6]/table-wrap[1]#Tab2", "version": null, "note": "List of primers used", "structure": {"pmcid": "PMC11926008", "section_index": 6, "section_title": "Real-time quantitative polymerase chain reaction (qPCR)", "row_count": 13, "column_count": 2}, "table": {"label": "Table 2", "caption": "List of primers used", "rows": [["Primer", "Primer Sequence (5′−3′)"], ["CUL1-F", "GGTTCGCCGTGAATGTGAC"], ["CUL1-R", "CCCCAATTCCACGTAAGACTGT"], ["SKP2-F", "ATGCCCCAATCTTGTCCATCT"], ["SKP2-R", "CACCGACTGAGTGATAGGTGT"], ["SQSTM1-F", "GACTACGACTTGTGTAGCGTC"], ["SQSTM1-R", "AGTGTCCGTGTTTCACCTTCC"], ["NBR1-F", "CAGTGCAGTCGTTTCCACTTG"], ["NBR1-R", "AGGTAGCTTGTGAACCAGTCT"], ["p27-F", "TAATTGGGGCTCCGGCTAACT"], ["p27-R", "TGCAGGTCGCTTCCTTATTCC"], ["β-actin-F", "ACCCTGAAGTACCCCATCGAG"], ["β-actin-R", "AGCACAGCCTGGATAGCAAC"]], "row_count": 13, "column_count": 2, "numeric_cells": 3, "header_rows": 1, "locator": "section[6]/table-wrap[1]#Tab2"}}], "gaps": ["asset:source:pmid:40111576 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:40111576", "asset:table:pmid:40111576:1", "asset:table:pmid:40111576:2"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:40111576"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "full-text-reading-v1", "prompt_hash": "e2c346d0baf3ed441e3c14ddc71d5ed30cd0ec60f1fc458d275f2a0372fd6f05", "source_hash": "62e5140fdfff5ae5f950ae8d1a51bb28f1b1317e283f6ad96e6e401f15e97d25", "raw_response_sha256": "sha256:267b38157f0e5eb0bdd2dd42a7c4f1031e98c365b2babf571bb836acadcffa96", "raw_response_chars": 3994}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "full-text-reading-v1", "prompt_hash": "96959653f8e922f2c84c582dbe692894df5323429e4329d2e86152f2a05f7dcb", "source_hash": "62e5140fdfff5ae5f950ae8d1a51bb28f1b1317e283f6ad96e6e401f15e97d25", "raw_response_sha256": "sha256:ec092c0d870e052eeab76fac6e4cd37be4c98e1066dc5ca848ec2177f1de361c", "raw_response_chars": 67734}], "target_providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "replication-target-v2", "prompt_hash": "c2fef1b3a042348baa11d80293ec709cf039822a431d28ce4620fabb957a96cc", "source_hash": "62e5140fdfff5ae5f950ae8d1a51bb28f1b1317e283f6ad96e6e401f15e97d25", "raw_response": "{\"parent_value\":0,\"unit\":\"\",\"evidence\":\"\",\"target_result\":\"The text states mechanistic findings—CUL1 neddylation enhances the SCF ubiquitin ligase complex to target p27 and link K29-linked polyubiquitin chains to p27, while NBR1 facilitates autophagic degradation of ubiquitinated p27—but gives no numerical result for the main finding.\",\"number_stated\":false}", "reading": {"parent_value": 0, "unit": "", "evidence": "", "target_result": "The text states mechanistic findings—CUL1 neddylation enhances the SCF ubiquitin ligase complex to target p27 and link K29-linked polyubiquitin chains to p27, while NBR1 facilitates autophagic degradation of ubiquitinated p27—but gives no numerical result for the main finding.", "number_stated": false, "source_locator": null}, "recorded_at": "2026-10-31T15:35:39.077810+00:00"}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "replication-target-v2", "prompt_hash": "8d339aca5837774332d79163ee25e41f143c07fa590829f603cd92ca38e54984", "source_hash": "62e5140fdfff5ae5f950ae8d1a51bb28f1b1317e283f6ad96e6e401f15e97d25", "raw_response": "<think>We need answer JSON only. Need interpret. Registered target \"headline numerical result paper states for its main finding\". Source text is abstract + methods, no headline numerical result for main finding. There are numbers but methods, not main result. Need set number_stated false, parent 0, unit/evidence empty, target_result say text states instead. Need exact perhaps \"no numerical result for main finding; reports mechanistic findings...\" Ensure target_result textual. Evidence empty mandated. JSON object. They ask \"single numerical result replication registered target has to reproduce\". Is there perhaps 60 mg/kg sorafenib? But headline numerical result main finding, not methodological dose. Text no quantitative result. Thus false. Need unit empty.\n\nCould target_result mention source states mechanistic findings and experimental details rather than headline numerical result. Need avoid invented. Exact output schema.</think>\n\n{\"parent_value\":0,\"unit\":\"\",\"evidence\":\"\",\"target_result\":\"The text states that NEDD8-mediated CUL1 neddylation promotes K29-linked polyubiquitination of p27, NBR1-facilitated autophagic degradation of ubiquitinated p27, and suppression of sorafenib resistance by CUL1 knockdown, but it gives no numerical result for the main finding.\",\"number_stated\":false}", "reading": {"parent_value": 0, "unit": "", "evidence": "", "target_result": "The text states that NEDD8-mediated CUL1 neddylation promotes K29-linked polyubiquitination of p27, NBR1-facilitated autophagic degradation of ubiquitinated p27, and suppression of sorafenib resistance by CUL1 knockdown, but it gives no numerical result for the main finding.", "number_stated": false, "source_locator": null}, "recorded_at": "2026-10-31T15:35:41.387897+00:00"}], "agreement": false, "disagreements": {"target_result": {"minimax": "No headline numerical result is stated in the supplied text; the main findings are qualitative.", "minimax_alt": "unknown", "decisive": false}, "physical_methods": {"minimax": ["mCherry-/eGFP-LC3B dual-fluorescent system", "Wild and mutant types of HA-labeled ubiquitin (K27, K29, K33, K48, K63, K29R and K48R)", "Tumor xenograft analysis"], "minimax_alt": ["mCherry-/eGFP-LC3B dual-fluorescent system for assessing autophagic state", "Wild and mutant HA-labeled ubiquitin constructs to identify the polyubiquitin-chain type added to p27 by CUL1", "CUL1 knockdown experiments in vitro and in vivo", "Tumor xenograft analysis in immunodeficient mice with sorafenib treatment and serial tumor-volume measurement"], "decisive": false}, "analysis_methods": {"minimax": ["Bioinformatics analysis based on GSE109211 and TCGA datasets"], "minimax_alt": ["Bioinformatics analysis of GSE109211 and TCGA datasets", "Data summarized as mean ± SEM from three independent experiments", "Unpaired Student t-test", "One-way ANOVA"], "decisive": false}, "statistical_method": {"minimax": "Unpaired Student t-test and one-way ANOVA", "minimax_alt": "Unpaired Student t-test for comparisons between two groups and one-way ANOVA for comparisons among more than two groups", "decisive": true}}, "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": []}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:e7417b21df8bc8f5f7aa17a55ad2a9337e379e21a1c475d3085f97591e78c5d7", "type": "sep_package", "label": "SEP v1 package for pmid:40111576"}], "activities": [{"id": "activity:conversion:pmid:40111576", "type": "conversion", "used": ["package:e7417b21df8bc8f5f7aa17a55ad2a9337e379e21a1c475d3085f97591e78c5d7"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:minimax", "type": "model", "label": "minimax"}, {"id": "agent:minimax_alt", "type": "model", "label": "minimax_alt"}, {"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:40111576", "parent_hash": "sha256:be4877797b92be0efbdcd743b4f1d0f250d241d830a5f17639310838c1b293dd", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:40111576 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40111576' does not resolve to a declared asset", "targets"]}