TRIB3 Is a Hub Gene in Steatohepatitis and Aggravates Lipid Deposition and Inflammation in Hepatocytes.

{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:40255971", "kind": "science-record", "revision": 2, "content_hash": "sha256:1bc871e2c74c0c0094908b86aa7eafe755e26c0c11c2a74c1430d2dacbc38c40", "created_at": "2026-11-01T10:25:50Z", "updated_at": "2026-11-01T14:01:40Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "TRIB3 Is a Hub Gene in Steatohepatitis and Aggravates Lipid Deposition and Inflammation in Hepatocytes.", "doi": "10.2147/dmso.s486377", "pmid": "40255971", "authors": null, "journal": "Diabetes, metabolic syndrome and obesity : targets and therapy", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:40255971"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:40255971", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40255971' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:40255971", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.2147/dmso.s486377", "sha256": "sha256:e9c8421976985897f408ac17eecb9b004aea476e99b50c8680b037e410545dd7", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.2147/dmso.s486377", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:40255971:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f57f5acb6f14ce7b26f8d9441396317e31557dd482533f5c132260e8c7305066", "bytes": 839, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#t0001", "version": null, "note": "Primers of RT–qPCR Assays", "structure": {"pmcid": "PMC12009121", "section_index": 11, "section_title": "RT–qPCR", "row_count": 11, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primers of RT–qPCR Assays", "rows": [["Gene Symbol", "Forward (5′ to 3′)", "Forward (5′ to 3′)"], ["TRIB3", "AAGCGGTTGGAGTTGGATGAC", "CACGATCTGGAGCAGTAGGTG"], ["CD36", "AAGCCAGGTATTGCAGTTCTTT", "GCATTTGCTGATGTCTAGCACA"], ["FASN", "AAGGACCTGTCTAGGTTTGATGC", "TGGCTTCATAGGTGACTTCCA"], ["SREBP1c", "ACAGTGACTTCCCTGGCCTAT", "GCATGGACGGGTACATCTTCAA"], ["SCD1", "TCTAGCTCCTATACCACCACCA", "TCGTCTCCAACTTATCTCCTCC"], ["IL6", "ACTCACCTCTTCAGAACGAATTG", "CCATCTTTGGAAGGTTCAGGTTG"], ["IL1b", "ATGATGGCTTATTACAGTGGCAA", "GTCGGAGATTCGTAGCTGGA"], ["CCL2", "CAGCCAGATGCAATCAATGCC", "TGGAATCCTGAACCCACTTCT"], ["CXCL12", "ATTCTCAACACTCCAAACTGTGC", "ACTTTAGCTTCGGGTCAATGC"], ["β–ACTIN", "CATGTACGTTGCTATCCAGGC", "CTCCTTAATGTCACGCACGAT"]], "row_count": 11, "column_count": 3, "numeric_cells": 4, "header_rows": 1, "locator": "section[11]/table-wrap[1]#t0001"}}, {"id": "asset:table:pmid:40255971:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8b5386bb3968d26e750229b5a3c61607b69c721fc317db1f6e613cf61e70a80e", "bytes": 1281, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#t0002", "version": null, "note": "The Top 20 Upregulated and Downregulated Genes of DEGs", "structure": {"pmcid": "PMC12009121", "section_index": 15, "section_title": "Bioinformation Analysis from the GSE122660 Dataset and Identification of DEGs", "row_count": 21, "column_count": 6}, "table": {"label": "Table 2", "caption": "The Top 20 Upregulated and Downregulated Genes of DEGs", "rows": [["Gene Symbol", "LogFC", "P value", "Gene Symbol", "LogFC", "P value"], ["LAMP3", "4.07", "0.00", "PITX2", "–2.28", "0.00"], ["FAM129A", "3.49", "0.00", "CCR6", "–2.28", "0.00"], ["INHBE", "2.69", "0.00", "CFHR5", "–2.11", "0.00"], ["PARM1", "2.68", "0.00", "SLC23A1", "–2.03", "0.00"], ["SLC3A2", "2.65", "0.00", "CLRN3", "–1.95", "0.00"], ["KLF4", "2.57", "0.00", "RBP2", "–1.92", "0.00"], ["SOCS2", "2.55", "0.00", "ALDH8A1", "–1.87", "0.00"], ["RAB39B", "2.48", "0.00", "CDH17", "–1.72", "0.02"], ["S100P", "2.41", "0.00", "ADH6", "–1.69", "0.00"], ["ZNF165", "2.38", "0.00", "HPR", "–1.68", "0.00"], ["FBXO16", "2.38", "0.00", "LGALS2", "–1.68", "0.01"], ["TMEM140", "2.33", "0.00", "NTS", "–1.65", "0.02"], ["KCNK6", "2.32", "0.00", "TFF2", "–1.62", "0.00"], ["SLC22A15", "2.16", "0.00", "GBA3", "–1.59", "0.00"], ["PLA1A", "2.13", "0.01", "CXCL10", "–1.59", "0.00"], ["CYP24A1", "2.11", "0.00", "NAT8B", "–1.58", "0.00"], ["FIBIN", "2.10", "0.00", "HIST1H2BC", "–1.56", "0.01"], ["EREG", "2.06", "0.00", "C6orf142", "–1.53", "0.00"], ["PPP1R15A", "2.03", "0.00", "HIST1H2AL", "–1.52", "0.00"], ["DDIT3", "1.98", "0.00", "LOC100128191", "–1.50", "0.00"]], "row_count": 21, "column_count": 6, "numeric_cells": 94, "header_rows": 1, "locator": "section[15]/table-wrap[1]#t0002"}}, {"id": "asset:table:pmid:40255971:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a23d0a3535c16621edb63be48b0d61a888d41c2c2f3d1781e05253dfecdb3f30", "bytes": 976, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#t0003", "version": null, "note": "The Hub Genes of DEGs", "structure": {"pmcid": "PMC12009121", "section_index": 17, "section_title": "Protein–Protein Interaction Network Construction and Hub Gene Identification", "row_count": 11, "column_count": 8}, "table": {"label": "Table 3", "caption": "The Hub Genes of DEGs", "rows": [["Gene Symbol", "LogFC", "P value", "Connectivity Score", "Gene Symbol", "LogFC", "P value", "Connectivity Score"], ["JUN", "1.13", "0.00", "11,161.17", "KNG1", "–1.03", "0.01", "1245.78"], ["CDKN3", "–1.22", "0.01", "3306.87", "HIST1H2BD", "–1.33", "0.00", "1214.76"], ["EIF2AK3", "1.01", "0.00", "2471.94", "VLDLR", "1.82", "0.00", "1155.50"], ["ANXA1", "1.62", "0.01", "2035.02", "CPT1A", "1.14", "0.00", "1116.11"], ["EHHADH", "–1.07", "0.01", "1842.91", "PPP1R15A", "2.03", "0.00", "1075.32"], ["CXCL10", "–1.59", "0.00", "1839.36", "MTTP", "–1.43", "0.02", "1003.67"], ["TRIB3", "1.83", "0.00", "1710.07", "DDIT3", "1.98", "0.00", "1000.77"], ["AGXT2", "–1.23", "0.00", "1661.30", "SELS", "1.02", "0.01", "982.16"], ["ALDH8A1", "–1.87", "0.00", "1621.82", "HYOU1", "1.21", "0.00", "950.07"], ["TFF1", "–1.04", "0.01", "1505.68", "GADD45A", "1.56", "0.00", "879.55"]], "row_count": 11, "column_count": 8, "numeric_cells": 63, "header_rows": 1, "locator": "section[17]/table-wrap[1]#t0003"}}], "gaps": ["asset:source:pmid:40255971 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:40255971", "asset:table:pmid:40255971:1", "asset:table:pmid:40255971:2", "asset:table:pmid:40255971:3"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:40255971"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [], "target_providers": [], "agreement": false, "disagreements": [], "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": [{"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}]}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:057d19a021075559ec967ecb602b4946aec717d58b0f9c69fe738625b431d7c6", "type": "sep_package", "label": "SEP v1 package for pmid:40255971"}], "activities": [{"id": "activity:conversion:pmid:40255971", "type": "conversion", "used": ["package:057d19a021075559ec967ecb602b4946aec717d58b0f9c69fe738625b431d7c6"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:40255971", "parent_hash": "sha256:19f38b4d848a64fc92c07ec2bd664dcef2465758a488c026e0e61f2a4291a270", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:40255971 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40255971' does not resolve to a declared asset", "targets"]}