← All .science files
pmid:40547309
Mito-fission gene prognostic model for colorectal cancer.
PeerJ · 2025 doi:10.7717/peerj.19522
Paper
partial
Experiment
partial
Data
partial
Analysis
absent
Execution
absent
Execution evidence has not yet been added to this .science file. Explore its methods, data and open questions to plan the next step.
Record details sci_version · id · kind · revision · content_hash · schema · created_at · updated_at · generator
generator object · 3 fields
experiment object · 8 fields
steps array · 3 items
[0] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[1] object · 13 fields
parameters object · 0 fields
inputs array · 0 items
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[2] object · 13 fields
parameters object · 0 fields
inputs array · 0 items
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
materials array · 0 items
instruments array · 0 items
reagents array · 0 items
conditions object · 0 fields
gaps array · 3 items
data object · 3 fields
assets array · 6 items
[0] object · 15 fields
structure object · 1 field
[1] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 41 items
[0] array · 2 items
[1] array · 2 items
[2] array · 2 items
[3] array · 2 items
[4] array · 2 items
[5] array · 2 items
[6] array · 2 items
[7] array · 2 items
[8] array · 2 items
[9] array · 2 items
[10] array · 2 items
[11] array · 2 items
[12] array · 2 items
[13] array · 2 items
[14] array · 2 items
[15] array · 2 items
[16] array · 2 items
[17] array · 2 items
[18] array · 2 items
[19] array · 2 items
[20] array · 2 items
[21] array · 2 items
[22] array · 2 items
[23] array · 2 items
[24] array · 2 items
[25] array · 2 items
[26] array · 2 items
[27] array · 2 items
[28] array · 2 items
[29] array · 2 items
[30] array · 2 items
[31] array · 2 items
[32] array · 2 items
[33] array · 2 items
[34] array · 2 items
[35] array · 2 items
[36] array · 2 items
[37] array · 2 items
[38] array · 2 items
[39] array · 2 items
[40] array · 2 items
[2] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 9 items
[0] array · 2 items
[1] array · 2 items
[2] array · 2 items
[3] array · 2 items
[4] array · 2 items
[5] array · 2 items
[6] array · 2 items
[7] array · 2 items
[8] array · 2 items
[3] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 11 items
[0] array · 5 items
[1] array · 5 items
[2] array · 5 items
[3] array · 5 items
[4] array · 5 items
[5] array · 5 items
[6] array · 5 items
[7] array · 5 items
[8] array · 5 items
[9] array · 5 items
[10] array · 5 items
[4] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 4 items
[0] array · 6 items
[1] array · 6 items
[2] array · 6 items
[3] array · 6 items
[5] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 72 items
[0] array · 7 items
[1] array · 7 items
[2] array · 7 items
[3] array · 7 items
[4] array · 7 items
[5] array · 7 items
[6] array · 7 items
[7] array · 7 items
[8] array · 7 items
[9] array · 7 items
[10] array · 7 items
[11] array · 7 items
[12] array · 7 items
[13] array · 7 items
[14] array · 7 items
[15] array · 7 items
[16] array · 7 items
[17] array · 7 items
[18] array · 7 items
[19] array · 7 items
[20] array · 7 items
[21] array · 7 items
[22] array · 7 items
[23] array · 7 items
[24] array · 7 items
[25] array · 7 items
[26] array · 7 items
[27] array · 7 items
[28] array · 7 items
[29] array · 7 items
[30] array · 7 items
[31] array · 7 items
[32] array · 7 items
[33] array · 7 items
[34] array · 7 items
[35] array · 7 items
[36] array · 7 items
[37] array · 7 items
[38] array · 7 items
[39] array · 7 items
[40] array · 7 items
[41] array · 7 items
[42] array · 7 items
[43] array · 7 items
[44] array · 7 items
[45] array · 7 items
[46] array · 7 items
[47] array · 7 items
[48] array · 7 items
[49] array · 7 items
[50] array · 7 items
[51] array · 7 items
[52] array · 7 items
[53] array · 7 items
[54] array · 7 items
[55] array · 7 items
[56] array · 7 items
[57] array · 7 items
[58] array · 7 items
[59] array · 7 items
[60] array · 7 items
[61] array · 7 items
[62] array · 7 items
[63] array · 7 items
[64] array · 7 items
[65] array · 7 items
[66] array · 7 items
[67] array · 7 items
[68] array · 7 items
[69] array · 7 items
[70] array · 7 items
[71] array · 7 items
gaps array · 1 item
capability object · 3 fields
readiness object · 8 fields
axes object · 0 fields
can_run object · 3 fields
dsl_operations array · 0 items
assets array · 6 items
steps array · 1 item
must_build object · 5 fields
dsl_operations array · 0 items
converters array · 0 items
readers array · 1 item
capabilities array · 0 items
data_gaps array · 1 item
gaps array · 1 item
review object · 5 fields
machine_critique object · 7 fields
providers array · 0 items
target_providers array · 0 items
disagreements array · 0 items
agreement_basis object · 2 fields
decisive_fields array · 4 items
human_critique object · 5 fields
stages array · 7 items
[0] object · 4 fields
[1] object · 4 fields
evidence object · 1 field
provider_errors array · 4 items
[0] object · 4 fields
[1] object · 4 fields
[2] object · 4 fields
[3] object · 4 fields
[2] object · 4 fields
[3] object · 4 fields
[4] object · 4 fields
[5] object · 4 fields
[6] object · 4 fields
gaps array · 3 items
provenance object · 7 fields
entities array · 1 item
activities array · 1 item
agents array · 1 item
lineage object · 4 fields
gaps array · 14 items
Complete file
{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:40547309", "kind": "science-record", "revision": 2, "content_hash": "sha256:00368366a914518d28bb233532ea82d8ad8881565d7249d2dcf4eb49e828f508", "created_at": "2026-11-01T10:25:51Z", "updated_at": "2026-11-01T14:01:42Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "Mito-fission gene prognostic model for colorectal cancer.", "doi": "10.7717/peerj.19522", "pmid": "40547309", "authors": null, "journal": "PeerJ", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:40547309"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:40547309", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40547309' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:40547309", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.7717/peerj.19522", "sha256": "sha256:606748f8ce65e4dfc14015fe44aab8973f3e133749e05d0f2db6828f2e788f71", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.7717/peerj.19522", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:40547309:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8bad0916f06cf63e39507665afa48fef1da1aabfbde06d8dda93838fe91fb032", "bytes": 778, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#table-1", "version": null, "note": "List of 40 MFRGs.", "structure": {"pmcid": "PMC12182055", "section_index": 3, "section_title": "Data extraction", "row_count": 41, "column_count": 2}, "table": {"label": "Table 1", "caption": "List of 40 MFRGs.", "rows": [["Number", "Symbol"], ["1", "DNM1L"], ["2", "RALBP1"], ["3", "MTFR2"], ["4", "LRRK2"], ["5", "MIEF2"], ["6", "COX10"], ["7", "C11orf65"], ["8", "DCN"], ["9", "PGAM5"], ["10", "DDHD2"], ["11", "KDR"], ["12", "MAPT"], ["13", "OPA1"], ["14", "PRKN"], ["15", "FIS1"], ["16", "MTFP1"], ["17", "CYRIB"], ["18", "GDAP1"], ["19", "MIEF1"], ["20", "PPARG"], ["21", "MARCHF5"], ["22", "VPS35"], ["23", "MTFR1L"], ["24", "SPIRE1"], ["25", "MFF"], ["26", "RALA"], ["27", "INF2"], ["28", "PINK1"], ["29", "TMEM135"], ["30", "BNIP3"], ["31", "STAT2"], ["32", "AURKA"], ["33", "UCP2"], ["34", "MUL1"], ["35", "MYO19"], ["36", "DDHD1"], ["37", "AP3B1"], ["38", "MCU"], ["39", "SLC25A46"], ["40", "MTFR1"]], "row_count": 41, "column_count": 2, "numeric_cells": 46, "header_rows": 1, "locator": "section[3]/table-wrap[1]#table-1"}}, {"id": "asset:table:pmid:40547309:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:91e7f050fbfce752b7c82466bca358b3a8ca17e54cabfcb4a4e72e4067ecf96a", "bytes": 543, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#table-2", "version": null, "note": "Primer sequence information for RT-qPCR.", "structure": {"pmcid": "PMC12182055", "section_index": 15, "section_title": "RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR)", "row_count": 9, "column_count": 2}, "table": {"label": "Table 2", "caption": "Primer sequence information for RT-qPCR.", "rows": [["Primer", "Sequence"], ["CCDC68 F", "TGCCTTGTATGAGTCTACGTCC"], ["CCDC68 R", "AGCCCTGTTGAAGGTTTCCAC"], ["FAM151A F", "CTGAATGTGGAGTGGCTGGT"], ["FAM151A R", "TTCTGTGTCTGGGAGGGTCA"], ["MC1R F", "GTGTCGAAATGTCCTGGGGA"], ["MC1R R", "GACACCTCCTGGCATCTACC"], ["Internal reference-GAPDH F", "CGAAGGTGGAGTCAACGGATTT"], ["Internal reference-GAPDH R", "ATGGGTGGAATCATATTGGAAC"]], "row_count": 9, "column_count": 2, "numeric_cells": 4, "header_rows": 1, "locator": "section[15]/table-wrap[1]#table-2"}}, {"id": "asset:table:pmid:40547309:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:bac1b2df95558ae0015ea4f98bcd8822ae545f6ec3e41ffa4a9cdce741a30d38", "bytes": 2347, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[1]#table-3", "version": null, "note": "List of functional information for ten genes from univariate Cox analysis.", "structure": {"pmcid": "PMC12182055", "section_index": 23, "section_title": "Identification of hub gene and risk model construction", "row_count": 11, "column_count": 5}, "table": {"label": "Table 3", "caption": "List of functional information for ten genes from univariate Cox analysis.", "rows": [["", "Full name", "Function", "Correlation with cancer", "Correlation with mitochondrial dysregulation"], ["HIGD1A", "HIG1 Hypoxia Inducible Domain Family Member 1A", "Regulating polyamine metabolism, inhibited tumor growth and metastasis", "colon cancer (PMID: 37479180)", "Mitochondrial inner membrane protein, regulating metabolic homeostasis (PMID: 37492734)"], ["DIAPH3", "Diaphanous Related Formin 3", "Involved in actin remodeling and regulate cell movement and adhesion, promote migration and invasion of CRC cells", "colorectal cancer (PMID: 39843730)", "NA"], ["CCDC68", "Coiled-Coil Domain Containing 68", "Involved in microtubule anchoring at centrosome and protein localization", "colorectal cancer (PMID: 35557589)", "NA"], ["FAM151A", "Family With Sequence Similarity 151 Member A", "Highly expressed in the intestine, kidney and spleen (PMID: 31949211)", "NA", "NA"], ["KRTAP5.1", "Keratin Associated Protein 5-1", "Essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins (PMID: 37014946)", "NA", "NA"], ["HSF4", "Heat Shock Transcription Factor 4", "Promotes the proliferation and metastasis of CRC by regulating EMT-related signalling pathways", "colorectal cancer (PMID: 39881364)", "NA"], ["MC1R", "Melanocortin 1 Receptor", "Regulates T regulatory cell differentiation through metabolic reprogramming to promote colon cancer", "colorectal cancer (PMID: 38917522)", "Suppressing the oxidative stress, apoptosis, and mitochondrial fission through the AMPK/SIRT1/PGC-1α signaling pathway (PMID: 33391490)"], ["ZNF692", "Zinc Finger Protein 692", "Promotes the progression of colorectal cancer by regulating HSF4 expression", "colorectal cancer (PMID: 38435777)", "NA"], ["LIME1", "Lck Interacting Transmembrane Adaptor 1", "Docking protein to recruit signaling molecules, and involved in inflammatory pathways", "bladder cancer (PMID: 39429662)", "NA"], ["TTYH3", "Tweety Family Member 3", "Plays a role in tissue formation, embryonic development, and immune response to pathogen related molecules", "colorectal cancer (PMID: 38827027)", "NA"]], "row_count": 11, "column_count": 5, "numeric_cells": 26, "header_rows": 1, "locator": "section[23]/table-wrap[1]#table-3"}}, {"id": "asset:table:pmid:40547309:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d0d5247632aef84626e9ee870a3c2ca3d85f3cfede4f9c634f75e7b0ecad4f9f", "bytes": 455, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[2]#table-4", "version": null, "note": "Results of stepwise regression analysis.", "structure": {"pmcid": "PMC12182055", "section_index": 23, "section_title": "Identification of hub gene and risk model construction", "row_count": 4, "column_count": 6}, "table": {"label": "Table 4", "caption": "Results of stepwise regression analysis.", "rows": [["Gene", "coef", "exp (coef)", "se (coef)", "z", "Pr (>|z|)"], ["CCDC68", "−0.30553", "0.736733", "0.141426", "−2.16035", "0.030746"], ["FAM151A", "−0.97326", "0.377849", "0.31981", "−3.04325", "0.00234"], ["MC1R", "0.797626", "2.220264", "0.181711", "4.389539", "1.14E−05"]], "row_count": 4, "column_count": 6, "numeric_cells": 17, "header_rows": 1, "locator": "section[23]/table-wrap[2]#table-4"}}, {"id": "asset:table:pmid:40547309:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:39a09e5bd7042204a24983a94ee20ca0f39313c44a6ae0024521c8d5d52fd741", "bytes": 6074, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[27]/table-wrap[1]#table-5", "version": null, "note": "Table of relevant information on 71 discrepant drugs.", "structure": {"pmcid": "PMC12182055", "section_index": 27, "section_title": "Fifty-one common chemotherapeutic drugs were effective in high-risk patients for CRC", "row_count": 72, "column_count": 7}, "table": {"label": "Table 5", "caption": "Table of relevant information on 71 discrepant drugs.", "rows": [["drugs", "high_group_res", "low_group_res", "padj", "pvalue", "log2FoldChange", "References"], ["Mitomycin.C", "−1.011", "−1.029", "0.09352216", "0.048116473", "0.028560435", "PMID: 39531120"], ["Sorafenib", "3.844", "3.826", "0.083005791", "0.042104387", "0.014156188", "PMID: 39577235"], ["VX.680", "2.478", "2.364", "0.075511125", "0.037755563", "0.039769178", ""], ["X17.AAG", "−0.9516", "−0.8502", "0.072798168", "0.035871561", "−0.144174664", ""], ["Methotrexate", "0.9782", "0.953", "0.064334946", "0.031235082", "0.021896508", "PMID: 363377"], ["AZD.2281", "4.856", "4.915", "0.059041856", "0.028237409", "−0.090080215", "PMID: 36082969"], ["GSK.650394", "4.256", "4.187", "0.055894746", "0.026327236", "0.05820392", ""], ["CGP.082996", "4.036", "4.07", "0.04924791", "0.022839611", "−0.033324433", ""], ["ABT.263", "2.787", "2.855", "0.042698772", "0.019492918", "−0.066165992", ""], ["MK.2206", "2.807", "2.837", "0.041125831", "0.018476823", "−0.02663862", ""], ["KIN001.135", "6.118", "6.134", "0.033967735", "0.015014723", "−0.022779748", ""], ["JNK.9L", "−0.06688", "−0.0392", "0.031843664", "0.013845071", "−0.046716942", ""], ["AP.24534", "1.758", "1.855", "0.031843664", "0.01364931", "−0.124897566", "PMID: 38722621"], ["RDEA119", "2.148", "1.979", "0.031843664", "0.013543565", "0.117379887", ""], ["Roscovitine", "4.827", "4.81", "0.025538218", "0.010548395", "0.005275309", ""], ["TW.37", "−0.3615", "−0.2439", "0.021059601", "0.008545925", "−0.112737783", ""], ["Camptothecin", "−3.94", "−3.873", "0.021059601", "0.008499383", "−0.189793129", "PMID: 16990856"], ["Rapamycin", "−0.1547", "−0.2284", "0.021059601", "0.008429995", "0.028144422", "PMID: 37057884"], ["JNJ.26854165", "2.853", "2.903", "0.019286462", "0.007407119", "−0.096412009", ""], ["KU.55933", "5.121", "5.135", "0.018646596", "0.007026254", "−0.018304948", ""], ["A.770041", "3.721", "3.837", "0.018080039", "0.006681753", "−0.125054936", ""], ["Axitinib", "3.562", "3.638", "0.016782954", "0.006080781", "−0.070962035", "PMID: 39851927"], ["IPA.3", "5.828", "5.935", "0.016529912", "0.005869317", "−0.083331087", ""], ["AZD8055", "0.362", "0.3714", "0.015447953", "0.005373201", "−0.013423386", ""], ["GW843682X", "−2.316", "−2.338", "0.015309048", "0.005213951", "0.008854699", ""], ["AZD6482", "3.629", "3.789", "0.015068095", "0.005022698", "−0.129862683", ""], ["NSC.87877", "6.735", "6.766", "0.013382545", "0.004363873", "−0.024400818", ""], ["EHT.1864", "4.778", "4.85", "0.013382545", "0.004300615", "−0.061736239", ""], ["VX.702", "4.406", "4.467", "0.011565574", "0.003603766", "−0.040968786", ""], ["SB590885", "4.975", "4.915", "0.010444852", "0.003178868", "0.056102008", ""], ["BI.2536", "−1.595", "−1.692", "0.010444852", "0.003117351", "0.07229982", ""], ["AZD6244", "2.899", "2.721", "0.010435655", "0.003024827", "0.119951365", ""], ["Docetaxel", "−5.362", "−5.26", "0.007690955", "0.002173531", "−0.177536721", "PMID: 39911148"], ["NVP.BEZ235", "−2.387", "−2.266", "0.007245434", "0.00199512", "−0.119126921", ""], ["NU.7441", "3.534", "3.595", "0.006978244", "0.001870979", "−0.078773514", ""], ["Bryostatin.1", "−1.129", "−1.09", "0.006422026", "0.001675311", "−0.037451029", ""], ["NVP.TAE684", "1.689", "1.721", "0.006218487", "0.001577153", "−0.062869173", ""], ["ZM.447439", "2.739", "2.766", "0.005392136", "0.001328497", "−0.029209727", ""], ["Metformin", "10.65", "10.53", "0.005392136", "0.001300887", "0.083124597", "PMID: 39861414"], ["PD.173074", "4.122", "4.184", "0.005392136", "0.00128624", "−0.080062717", ""], ["OSI.906", "3.718", "3.84", "0.005392136", "0.001217238", "−0.132662293", ""], ["Midostaurin", "0.8398", "0.9802", "0.004306115", "0.000936112", "−0.127502408", "PMID: 28644114"], ["Dasatinib", "2.085", "2.413", "0.003827739", "0.00080438", "−0.290838304", "PMID: 36322825"], ["Bexarotene", "4.739", "4.761", "0.003827739", "0.000803033", "−0.029905707", "PMID: 39007945"], ["GDC.0449", "5.653", "5.714", "0.003030732", "0.000592969", "−0.055388504", "PMID: 24756807"], ["AZD7762", "0.1399", "0.3149", "0.002536853", "0.000477958", "−0.17295287", ""], ["Imatinib", "4.954", "4.978", "0.002422395", "0.00043884", "−0.028950786", "PMID: 39023605"], ["RO.3306", "4.803", "4.885", "0.001404402", "0.000244244", "−0.099624065", ""], ["Epothilone.B", "−4.903", "−5.04", "0.001241353", "0.000206892", "0.148448881", ""], ["GSK269962A", "3.635", "3.755", "0.001241353", "0.00020276", "−0.18013549", ""], ["AZD.0530", "4.053", "4.181", "0.000977892", "0.00014881", "−0.147212978", ""], ["JNK.Inhibitor.VIII", "5.833", "5.886", "6.28E−05", "6.37E−06", "−0.054132883", ""], ["Vinorelbine", "−3.475", "−3.62", "0.000415296", "6.02E−05", "0.146138882", "PMID: 39776939"], ["WO2009093972", "2.971", "3.128", "6.18E−05", "5.82E−06", "−0.167943832", ""], ["PD.0325901", "0.22", "0.01011", "0.000411263", "5.66E−05", "0.170290237", ""], ["Shikonin", "0.1304", "0.3193", "8.96E−06", "5.19E−07", "−0.171613126", ""], ["Pazopanib", "4.534", "4.644", "5.18E−05", "4.51E−06", "−0.135988084", "PMID: 36877187"], ["Temsirolimus", "−1.091", "−1.049", "0.000333998", "4.36E−05", "−0.06551927", "PMID: 22861825"], ["CMK", "3.639", "3.663", "0.000333998", "4.13E−05", "−0.022727652", ""], ["BMS.708163", "4.986", "4.938", "4.99E−05", "3.98E−06", "0.049136545", ""], ["Elesclomol", "−2.976", "−2.739", "4.99E−05", "3.82E−06", "−0.257894071", ""], ["GDC0941", "2.169", "2.222", "4.99E−05", "3.57E−06", "−0.055258206", ""], ["FTI.277", "3.699", "3.757", "0.000298753", "3.46E−05", "−0.061556158", ""], ["BIBW2992", "2.279", "2.206", "3.09E−09", "2.24E−11", "0.076788254", "PMID: 39894491"], ["X681640", "2.668", "2.531", "4.28E−06", "2.17E−07", "0.16932215", ""], ["CI.1040", "2.62", "2.595", "0.000163328", "1.78E−05", "0.022405468", ""], ["GNF.2", "4.505", "4.575", "3.91E−06", "1.70E−07", "−0.083372586", ""], ["AMG.706", "4.112", "4.193", "7.28E−09", "1.58E−10", "−0.104445814", ""], ["AG.014699", "4.157", "4.187", "4.37E−08", "1.27E−09", "−0.040279378", "PMID: 30830551"], ["LFM.A13", "6.142", "6.205", "2.83E−07", "1.02E−08", "−0.065518629", ""], ["CCT007093", "5.597", "5.626", "7.03E−09", "1.02E−10", "−0.024293532", ""]], "row_count": 72, "column_count": 7, "numeric_cells": 425, "header_rows": 1, "locator": "section[27]/table-wrap[1]#table-5"}}], "gaps": ["asset:source:pmid:40547309 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:40547309", "asset:table:pmid:40547309:1", "asset:table:pmid:40547309:2", "asset:table:pmid:40547309:3", "asset:table:pmid:40547309:4", "asset:table:pmid:40547309:5"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:40547309"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [], "target_providers": [], "agreement": false, "disagreements": [], "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": [{"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}]}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:b5db1246b72a2639411a3cc3304c5662b2257d4bcd7fc03f9b3b87201b184c3b", "type": "sep_package", "label": "SEP v1 package for pmid:40547309"}], "activities": [{"id": "activity:conversion:pmid:40547309", "type": "conversion", "used": ["package:b5db1246b72a2639411a3cc3304c5662b2257d4bcd7fc03f9b3b87201b184c3b"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:40547309", "parent_hash": "sha256:ea0e3d027cad337e8bf37b3e13c11eed043883fa87910ff5688a82f913585c2d", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:40547309 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40547309' does not resolve to a declared asset", "targets"]}