← All .science files
pmid:40612005
KRT6A, KRT6B, PKP1, and PKP3 as key hub genes in esophageal cancer: A combined bioinformatics and experimental study.
Biochemistry and biophysics reports · 2025 doi:10.1016/j.bbrep.2025.102095
Paper
partial
Experiment
partial
Data
partial
Analysis
absent
Execution
absent
Execution evidence has not yet been added to this .science file. Explore its methods, data and open questions to plan the next step.
Record details sci_version · id · kind · revision · content_hash · schema · created_at · updated_at · generator
generator object · 3 fields
paper object · 10 fields
claims array · 1 item
gaps array · 2 items
experiment object · 8 fields
steps array · 3 items
[0] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[1] object · 13 fields
parameters object · 0 fields
inputs array · 0 items
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[2] object · 13 fields
parameters object · 0 fields
inputs array · 0 items
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
materials array · 0 items
instruments array · 0 items
reagents array · 0 items
conditions object · 0 fields
gaps array · 3 items
data object · 3 fields
assets array · 6 items
[0] object · 15 fields
structure object · 1 field
[1] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 11 items
[0] array · 3 items
[1] array · 4 items
[2] array · 2 items
[3] array · 4 items
[4] array · 2 items
[5] array · 4 items
[6] array · 2 items
[7] array · 4 items
[8] array · 2 items
[9] array · 4 items
[10] array · 2 items
[2] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 6 items
[0] array · 3 items
[1] array · 4 items
[2] array · 5 items
[3] array · 5 items
[4] array · 5 items
[5] array · 5 items
[3] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 32 items
[0] array · 6 items
[1] array · 4 items
[2] array · 1 item
[3] array · 8 items
[4] array · 8 items
[5] array · 1 item
[6] array · 8 items
[7] array · 8 items
[8] array · 1 item
[9] array · 8 items
[10] array · 8 items
[11] array · 8 items
[12] array · 1 item
[13] array · 8 items
[14] array · 8 items
[15] array · 8 items
[16] array · 1 item
[17] array · 8 items
[18] array · 8 items
[19] array · 1 item
[20] array · 8 items
[21] array · 8 items
[22] array · 8 items
[23] array · 1 item
[24] array · 8 items
[25] array · 8 items
[26] array · 1 item
[27] array · 8 items
[28] array · 8 items
[29] array · 1 item
[30] array · 8 items
[31] array · 8 items
[4] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 32 items
[0] array · 6 items
[1] array · 4 items
[2] array · 1 item
[3] array · 8 items
[4] array · 8 items
[5] array · 1 item
[6] array · 8 items
[7] array · 8 items
[8] array · 1 item
[9] array · 8 items
[10] array · 8 items
[11] array · 8 items
[12] array · 1 item
[13] array · 8 items
[14] array · 8 items
[15] array · 8 items
[16] array · 1 item
[17] array · 8 items
[18] array · 8 items
[19] array · 1 item
[20] array · 8 items
[21] array · 8 items
[22] array · 8 items
[23] array · 1 item
[24] array · 8 items
[25] array · 8 items
[26] array · 1 item
[27] array · 8 items
[28] array · 8 items
[29] array · 1 item
[30] array · 8 items
[31] array · 8 items
[5] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 5 items
[0] array · 6 items
[1] array · 6 items
[2] array · 6 items
[3] array · 6 items
[4] array · 6 items
gaps array · 1 item
capability object · 3 fields
readiness object · 8 fields
axes object · 0 fields
can_run object · 3 fields
dsl_operations array · 0 items
assets array · 6 items
steps array · 1 item
must_build object · 5 fields
dsl_operations array · 0 items
converters array · 0 items
readers array · 1 item
capabilities array · 0 items
data_gaps array · 1 item
gaps array · 1 item
review object · 5 fields
machine_critique object · 7 fields
providers array · 0 items
target_providers array · 0 items
disagreements array · 0 items
agreement_basis object · 2 fields
decisive_fields array · 4 items
human_critique object · 5 fields
stages array · 7 items
[0] object · 4 fields
[1] object · 4 fields
evidence object · 1 field
provider_errors array · 4 items
[0] object · 4 fields
[1] object · 4 fields
[2] object · 4 fields
[3] object · 4 fields
[2] object · 4 fields
[3] object · 4 fields
[4] object · 4 fields
[5] object · 4 fields
[6] object · 4 fields
gaps array · 3 items
provenance object · 7 fields
entities array · 1 item
activities array · 1 item
agents array · 1 item
lineage object · 4 fields
gaps array · 14 items
Complete file
{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:40612005", "kind": "science-record", "revision": 2, "content_hash": "sha256:4ef068284d6f9d3aa1aa5f8229efa242ce62d245cd8fea691bb55482c066f2f4", "created_at": "2026-11-01T10:25:51Z", "updated_at": "2026-11-01T14:01:43Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "KRT6A, KRT6B, PKP1, and PKP3 as key hub genes in esophageal cancer: A combined bioinformatics and experimental study.", "doi": "10.1016/j.bbrep.2025.102095", "pmid": "40612005", "authors": null, "journal": "Biochemistry and biophysics reports", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:40612005"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:40612005", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_absent", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40612005' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:40612005", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1016/j.bbrep.2025.102095", "sha256": "sha256:15ced8885a738bddb7159ba569f40db11aea51a02d82013a81c268a17e9b22aa", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1016/j.bbrep.2025.102095", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:40612005:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:638c9008c6553d201e1abe7647308001c653b2e2bee1017c9370c9f6a727157d", "bytes": 633, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#tbl1", "version": null, "note": "The primer sequences.", "structure": {"pmcid": "PMC12226072", "section_index": 12, "section_title": "RNA extraction, cDNA synthesis, and RT-qPCR", "row_count": 11, "column_count": 4}, "table": {"label": "Table 1", "caption": "The primer sequences.", "rows": [["Gene", "", ""], ["KRT6A", "Human", "Forward", "GGATGCTTAGTGCCCTCACTTCT"], ["Reverse", "GCTCAGCCTCAGAGATAGAACAC"], ["KRT6B", "Human", "Forward", "TGCCCTCACTTTTCTTCTCATCA"], ["Reverse", "AGCTGGACCTAGACTGAGTTTC"], ["PKP1", "Human", "Forward", "GGGGATGTGATAAACAGGGCTAT"], ["Reverse", "AAGGGCACAGACCAGGAAGTT"], ["PKP3", "Human", "Forward", "CAACAAGCTCCACCGTGACT"], ["Reverse", "CCCTCCGTCATTAGCCTTCT"], ["β-actin", "Human", "Forward", "GAGCCTCGCCTTTGCCGATCC"], ["Reverse", "ACATGCCGGAGCCGTTGTCG"]], "row_count": 11, "column_count": 4, "numeric_cells": 0, "header_rows": 1, "locator": "section[12]/table-wrap[1]#tbl1"}}, {"id": "asset:table:pmid:40612005:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8707ddd43ca9a5be514c09740292d3c951cbe5a5c206f6ea9e821edcc219a8b8", "bytes": 487, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#tbl2", "version": null, "note": "log2FC values and adjusted p-values of KRT6A, KRT6B, PKP1, and PKP3 genes.", "structure": {"pmcid": "PMC12226072", "section_index": 17, "section_title": "Hub genes identification", "row_count": 6, "column_count": 5}, "table": {"label": "Table 2", "caption": "log2FC values and adjusted p-values of KRT6A, KRT6B, PKP1, and PKP3 genes.", "rows": [["Gene symbol", "GSE157808", "GSE92396"], ["log2FC", "Adjusted p-value", "log2FC", "Adjusted p-value"], ["KRT6A", "4.297", "0.007", "3.692", "0.013"], ["KRT6B", "4.316", "0.001", "3.441", "0.016"], ["PKP1", "3.571", "0.010", "3.347", "0.001"], ["PKP3", "2.854", "0.006", "1.542", "0.002"]], "row_count": 6, "column_count": 5, "numeric_cells": 18, "header_rows": 2, "locator": "section[17]/table-wrap[1]#tbl2"}}, {"id": "asset:table:pmid:40612005:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:dd58ff3d7b598a219cbaeb5e53330e15084078c8718a2a7705803f8f012a8017", "bytes": 2296, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[24]/table-wrap[1]#tbl3", "version": null, "note": "Association of KRT6A and KRT6B expression with clinico-pathological parameters in EC patients.", "structure": {"pmcid": "PMC12226072", "section_index": 24, "section_title": "Association between the expression of KRT6A, KRT6B, PKP1, and PKP3 genes and clinicopathological features of patients with EC", "row_count": 32, "column_count": 8}, "table": {"label": "Table 3", "caption": "Association of KRT6A and KRT6B expression with clinico-pathological parameters in EC patients.", "rows": [["Characteristics", "Number n (%)", "Expression of KRT6A", "χ2 p-value", "Expression of KRT6B", "χ2 p-value"], ["Low expression n (%)", "High expression n (%)", "Low expression n (%)", "High expression n (%)"], ["Gender"], ["Male", "8 (40 %)", "3 (30 %)", "5 (50 %)", "0.833", "3 (33.3 %)", "5 (45.5 %)", "0.303"], ["Female", "12 (60 %)", "7 (70 %)", "5 (50 %)", "0.361", "6 (66.7 %)", "6 (54.5 %)", "0.582"], ["Subtypes of EC"], ["EAC", "8 (40 %)", "4 (50 %)", "4 (50 %)", "1.352", "5 (50 %)", "3 (30 %)", "0.653"], ["ESCC", "12 (60 %)", "8 (66.67 %)", "4 (33.33 %)", "0.152", "5 (50 %)", "7 (70 %)", "0.384"], ["Grade"], ["1", "4 (20 %)", "2 (20 %)", "2 (20 %)", "0.267", "1 (11.1 %)", "3 (27.3 %)", "0.808"], ["2", "14 (70 %)", "7 (70 %)", "7 (70 %)", "0.606", "7 (77.8 %)", "7 (63.6 %)", "0.668"], ["3", "2 (10 %)", "1 (10 %)", "1 (10 %)", "", "1 (11.1 %)", "1 (9.1 %)", ""], ["Clinical stage"], ["II", "9 (20 %)", "3 (30 %)", "6 (60 %)", "3.6", "3 (33.3 %)", "6 (54.5 %)", "2.222"], ["III", "10 (70 %)", "7 (70 %)", "3 (30 %)", "0.165", "6 (66.7 %)", "4 (36.4 %)", "0.329"], ["IV", "1 (10 %)", "0 (0 %)", "1 (10 %)", "", "0 (0 %)", "1 (9.1 %)", ""], ["Necrosis"], ["Yes", "10 (50 %)", "6 (60 %)", "4 (40 %)", "0.8", "7 (77.8 %)", "3 (27.3 %)", "5.051"], ["No", "10 (50 %)", "4 (40 %)", "6 (60 %)", "0.371", "2 (22.2 %)", "8 (72.7 %)", "0.025∗"], ["Patological T"], ["T2", "5 (25 %)", "2 (20 %)", "3 (30 %)", "1.486", "1 (11.1 %)", "4 (36.4 %)", "2.626"], ["T3", "14 (70 %)", "8 (80 %)", "6 (60 %)", "0.476", "7 (77.8 %)", "7 (63.6 %)", "0.269"], ["T4", "1 (5 %)", "0 (0 %)", "1 (10 %)", "", "1 (11.1 %)", "0 (0 %)", ""], ["Lymph nodes"], ["N0", "8 (40 %)", "6 (60 %)", "2 (20 %)", "5.333", "2 (22.2 %)", "6 (54.5 %)", "2.155"], ["N1", "12 (60 %)", "4 (40 %)", "8 (80 %)", "0.047∗", "7 (77.8 %)", "5 (45.5 %)", "0.142"], ["Lymph invasion"], ["Yes", "5 (25 %)", "2 (20 %)", "3 (30 %)", "0.267", "1 (11.1 %)", "4 (36.4 %)", "1.684"], ["No", "15 (75 %)", "8 (80 %)", "7 (70 %)", "0.606", "8 (88.9 %)", "7 (63.6 %)", "0.194"], ["Vascular invasion"], ["Yes", "10 (50 %)", "4 (40 %)", "6 (60 %)", "0.8", "5 (55.6 %)", "5 (45.5 %)", "0.202"], ["No", "10 (50 %)", "6 (60 %)", "4 (40 %)", "0.371", "4 (44.4 %)", "6 (54.5 %)", "0.653"]], "row_count": 32, "column_count": 8, "numeric_cells": 146, "header_rows": 2, "locator": "section[24]/table-wrap[1]#tbl3"}}, {"id": "asset:table:pmid:40612005:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:03ae0746250e91869ddf27d63c101475163e9ae937e95b84d19ebfa4de02d07e", "bytes": 2284, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[24]/table-wrap[2]#tbl4", "version": null, "note": "Association of PKP1 and PKP3 expression with clinico-pathological parameters in EC patients.", "structure": {"pmcid": "PMC12226072", "section_index": 24, "section_title": "Association between the expression of KRT6A, KRT6B, PKP1, and PKP3 genes and clinicopathological features of patients with EC", "row_count": 32, "column_count": 8}, "table": {"label": "Table 4", "caption": "Association of PKP1 and PKP3 expression with clinico-pathological parameters in EC patients.", "rows": [["Characteristics", "Number n (%)", "Expression of PKP1", "χ2 p-value", "Expression of PKP3", "χ2 p-value"], ["Low expression n (%)", "High expression n (%)", "Low expression n (%)", "High expression n (%)"], ["Gender"], ["Male", "8 (40 %)", "4 (44.4 %)", "4 (36.4 %)", "0.135", "5 (50 %)", "3 (30 %)", "0.833"], ["Female", "12 (60 %)", "5 (55.6 %)", "7 (63.6 %)", "0.714", "5 (50 %)", "7 (70 %)", "0.361"], ["Subtypes of EC"], ["EAC", "8 (40 %)", "6 (54.5 %)", "2 (22.2 %)", "2.542", "5 (50 %)", "3 (30 %)", "0.653"], ["ESCC", "12 (60 %)", "5 (45.5 %)", "7 (77.8 %)", "0.172", "5 (50 %)", "7 (70 %)", "0.384"], ["Grade"], ["1", "4 (20 %)", "2 (22.2 %)", "2 (18.2 %)", "0.87", "2 (20 %)", "2 (20 %)", "2.286"], ["2", "14 (70 %)", "6 (66.7 %)", "8 (72.7 %)", "0.958", "6 (60 %)", "8 (80 %)", "0.319"], ["3", "2(10 %)", "1 (11.1 %)", "1 (9.1 %)", "", "2 (20 %)", "0 (0 %)", ""], ["Clinical stage"], ["II", "9 (45 %)", "2 (22.2 %)", "7 (63.6 %)", "6.23", "6 (60 %)", "3 (30 %)", "2.4"], ["III", "10 (50 %)", "7 (77.8 %)", "3 (27.3 %)", "0.043∗", "4 (40 %)", "6 (60 %)", "0.301"], ["IV", "1 (5 %)", "0 (0 %)", "1 (9.1 %)", "", "0 (0 %)", "1 (10 %)", ""], ["Necrosis"], ["Yes", "10 (50 %)", "5 (55.6 %)", "5 (45.5 %)", "0.202", "5 (50 %)", "5 (50 %)", "2.41"], ["No", "10 (50 %)", "4 (44.4 %)", "6 (54.5 %)", "0.653", "5 (50 %)", "5 (50 %)", "0.672"], ["Patological T"], ["T2", "5 (25 %)", "1 (11.1 %)", "4 (36.4 %)", "2.626", "3 (30 %)", "2 (20 %)", "1.2"], ["T3", "14 (70 %)", "7 (77.8 %)", "7 (63.6 %)", "0.269", "7 (70 %)", "7 (70 %)", "0.549"], ["T4", "1 (5 %)", "1 (11.1 %)", "0 (0 %)", "", "0 (0 %)", "1 (10 %)", ""], ["Lymph nodes"], ["N0", "8 (40 %)", "2 (22.2 %)", "6 (54.5 %)", "2.155", "5 (50 %)", "3 (30 %)", "0.833"], ["N1", "12 (60 %)", "7 (77.8 %)", "5 (45.5 %)", "0.142", "5 (50 %)", "7 (70 %)", "0.361"], ["Lymph invasion"], ["Yes", "5 (25 %)", "2 (22.2 %)", "3 (27.3 %)", "0.67", "2 (20 %)", "3 (30 %)", "0.267"], ["No", "15 (75 %)", "7 (77.8 %)", "8 (72.7 %)", "0.795", "8 (80 %)", "7 (72 %)", "0.606"], ["Vascular invasion"], ["Yes", "10 (50 %)", "5 (55.6 %)", "5 (45.5 %)", "0.202", "4 (40 %)", "6 (60 %)", "0.8"], ["No", "10 (50 %)", "4 (44.4 %)", "6 (54.5 %)", "0.653", "6 (60 %)", "4 (40 %)", "0.371"]], "row_count": 32, "column_count": 8, "numeric_cells": 146, "header_rows": 2, "locator": "section[24]/table-wrap[2]#tbl4"}}, {"id": "asset:table:pmid:40612005:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ea5ed6db1ec77e4e689796c136f1b933faaf33b2b61a8652c9823d60102c56dd", "bytes": 1245, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[24]/table-wrap[3]#tbl5", "version": null, "note": "An integrated summary of gene expression, immune correlation, clinical association, and pathway enrichment for KRT6A, KRT6B, PKP1, and PKP3 genes in EC.", "structure": {"pmcid": "PMC12226072", "section_index": 24, "section_title": "Association between the expression of KRT6A, KRT6B, PKP1, and PKP3 genes and clinicopathological features of patients with EC", "row_count": 5, "column_count": 6}, "table": {"label": "Table 5", "caption": "An integrated summary of gene expression, immune correlation, clinical association, and pathway enrichment for KRT6A, KRT6B, PKP1, and PKP3 genes in EC.", "rows": [["Gene", "GEPIA/TIMER Expression", "RT-qPCR Expression", "Immune Correlation (TIMER)", "Clinical Association", "Functional Enrichment (GO/KEGG)"], ["KRT6A", "Non-significant increases", "Up-regulation", "Negative correlation with B cells and Macrophages.Positively correlated with Neutrophils.", "Associated with lymph node metastasis", "BP: Epidermis development"], ["KRT6B", "Significant increase", "Up-regulation", "Negative correlation with B cells, CD4+ T cells, and Macrophages.", "Inverse association with necrosis", "CC: Intermediate filament"], ["PKP1", "Significant increase", "Up-regulation", "Negative correlation with B cells and CD4+ T cells.", "Associated with clinical stage", "MF: Structural constituent of skin epidermis"], ["PKP3", "Significant increase", "Up-regulation", "Negative correlation with B cells, CD4+ T cells, and Macrophages.", "No significant clinical correlation", "KEGG: Maturity onset diabetes of the young and TP53 signaling pathway"]], "row_count": 5, "column_count": 6, "numeric_cells": 1, "header_rows": 1, "locator": "section[24]/table-wrap[3]#tbl5"}}], "gaps": ["asset:source:pmid:40612005 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:40612005", "asset:table:pmid:40612005:1", "asset:table:pmid:40612005:2", "asset:table:pmid:40612005:3", "asset:table:pmid:40612005:4", "asset:table:pmid:40612005:5"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:40612005"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [], "target_providers": [], "agreement": false, "disagreements": [], "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": [{"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}]}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:b006262aac9c5a8878bf3e7c7dcf59cfc6e1c0ab686ab0d9eedbae2a3f5c9b17", "type": "sep_package", "label": "SEP v1 package for pmid:40612005"}], "activities": [{"id": "activity:conversion:pmid:40612005", "type": "conversion", "used": ["package:b006262aac9c5a8878bf3e7c7dcf59cfc6e1c0ab686ab0d9eedbae2a3f5c9b17"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:40612005", "parent_hash": "sha256:13cbbe6babf12518e39283e1c22494f488b4c941c9d826bfc6e9f55f7ad46f2e", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:40612005 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers", "step:obtain_source_data blocked on data:accession_absent", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40612005' does not resolve to a declared asset", "targets"]}