m6A RNA methylation regulator-associated genes drive metastasis and immune cell infiltration in skin cutaneous melanoma.

{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:41181626", "kind": "science-record", "revision": 2, "content_hash": "sha256:6b2a91646b76e4e5e265897062895ae5fecc5a9ee062b4d9658635f8d30af133", "created_at": "2026-11-01T10:25:53Z", "updated_at": "2026-11-01T14:01:50Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "m6A RNA methylation regulator-associated genes drive metastasis and immune cell infiltration in skin cutaneous melanoma.", "doi": "10.3892/ol.2025.15350", "pmid": "41181626", "authors": null, "journal": "Oncology letters", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:41181626"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:41181626", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:41181626' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:41181626", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3892/ol.2025.15350", "sha256": "sha256:39d582d16096d1b242b5ab7f841ee9d2d7bcb8a02e5b74ecf3a1af9697b254d7", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3892/ol.2025.15350", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:41181626:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0a40ad8e5035759c22cc5c59d8a59b00b9460e0ab04e314bb5bd020cb5cf1eac", "bytes": 555, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#tI-ol-30-6-15350", "version": null, "note": "Sample information.", "structure": {"pmcid": "PMC12574698", "section_index": 3, "section_title": "Patients and data collection", "row_count": 9, "column_count": 4}, "table": {"label": "Table I.", "caption": "Sample information.", "rows": [["Dataset", "Total number of samples", "Sample type", "Number of samples"], ["GSE8401", "83", "Primary melanoma", "31"], ["", "", "Metastatic melanoma", "52"], ["GSE15605", "74", "Primary melanoma", "46"], ["", "", "Metastatic melanoma", "12"], ["", "", "Normal skin samples", "16"], ["GSE46517", "104", "Primary melanoma", "31"], ["", "", "Metastatic melanoma", "73"], ["GSE65904", "210", "Melanoma", "210"]], "row_count": 9, "column_count": 4, "numeric_cells": 16, "header_rows": 1, "locator": "section[3]/table-wrap[1]#tI-ol-30-6-15350"}}, {"id": "asset:table:pmid:41181626:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7bdf902d4a58f73eee09c2908a164b857525992c2df5b6d8f182bfa50782ef69", "bytes": 701, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#tII-ol-30-6-15350", "version": null, "note": "Primers used in the reverse transcription-quantitative PCR assay.", "structure": {"pmcid": "PMC12574698", "section_index": 10, "section_title": "RNA extraction and reverse transcription-quantitative PCR (RT-qPCR)", "row_count": 8, "column_count": 5}, "table": {"label": "Table II.", "caption": "Primers used in the reverse transcription-quantitative PCR assay.", "rows": [["", "", "", "Primer sequence (5′-3′)"], ["", "", "", ""], ["Gene", "Species", "Amplicon length, bp", "Forward", "Reverse"], ["KRT17", "Human", "119", "GGTGGGTGGTGAGATCAATGT", "CGGCATCCTTGCGGTTCTT"], ["PKP1", "Human", "120", "TCAGCAACAAGAGCGACAAG", "TCAGGTAGGTGCGGATGG"], ["CDH3", "Human", "121", "TGGAGATCCTTGATGCCAATGA", "GCGTCCAGATCAGTGACCG"], ["CRABP2", "Human", "99", "TGAATGTGATGCTGAGGAAGAT", "TGGTGGAGGTTTTGATGTAGAA"], ["β-actin", "Human", "73", "GTGGCCGAGGACTTTGATTG", "CCTGTAACAACGCATCTCATATT"]], "row_count": 8, "column_count": 5, "numeric_cells": 7, "header_rows": 3, "locator": "section[10]/table-wrap[1]#tII-ol-30-6-15350"}}], "gaps": ["asset:source:pmid:41181626 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:41181626", "asset:table:pmid:41181626:1", "asset:table:pmid:41181626:2"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:41181626"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [], "target_providers": [], "agreement": false, "disagreements": [], "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": [{"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}]}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:ecaf6e58c7c593e82d78340deb65ddc32b659a20e11ab4eb01759c9537d01cf5", "type": "sep_package", "label": "SEP v1 package for pmid:41181626"}], "activities": [{"id": "activity:conversion:pmid:41181626", "type": "conversion", "used": ["package:ecaf6e58c7c593e82d78340deb65ddc32b659a20e11ab4eb01759c9537d01cf5"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:41181626", "parent_hash": "sha256:60b6d9013546984dc0f66763dc144b370749fca25a9dacfb676d82bc6df60304", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:41181626 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:41181626' does not resolve to a declared asset", "targets"]}