Analysis of the associations between DNA methylation and clinical features reveals the potential oncogenic effect of CFAP52 in esophageal squamous cell cancer.

{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:41214700", "kind": "science-record", "revision": 2, "content_hash": "sha256:812ff34f70d7997c998e1ab2c1b8aa7db2e9d6c8959e90a7454caf80866550bf", "created_at": "2026-11-01T10:25:53Z", "updated_at": "2026-11-01T14:01:50Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "Analysis of the associations between DNA methylation and clinical features reveals the potential oncogenic effect of CFAP52 in esophageal squamous cell cancer.", "doi": "10.1186/s12935-025-03934-4", "pmid": "41214700", "authors": null, "journal": "Cancer cell international", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:41214700"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:41214700", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:41214700' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:41214700", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12935-025-03934-4", "sha256": "sha256:5c977ddb7580a0e43d6d8ed120411cdeaf12688bcb37f8f454508d26fd7d68e2", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12935-025-03934-4", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:41214700:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5afba92cbf1905ca23b5c6d34d72c878f471881a3261644edb2291c26d294340", "bytes": 782, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#Tab1", "version": null, "note": "The clinical characteristics of 96 ESCC patients included in this study", "structure": {"pmcid": "PMC12604410", "section_index": 3, "section_title": "Data collection and processing", "row_count": 25, "column_count": 2}, "table": {"label": "Table 1", "caption": "The clinical characteristics of 96 ESCC patients included in this study", "rows": [["Clinical characteristics", "Number of patients"], ["Sex", ""], ["Male", "81"], ["Female", "15"], ["Age", ""], ["≥ 57", "54"], ["< 57", "42"], ["Alcohol history", "a"], ["Yes", "69"], ["No", "25"], ["TNM stage", "b"], ["Stage I + II", "63"], ["Stage III + IV", "31"], ["Overall survival status", ""], ["Death", "32"], ["Survival", "64"], ["Median time (days): 386.5", ""], ["Disease-free survival status", ""], ["Death", "20"], ["Survival", "76"], ["Median time (days): 386.5", ""], ["Progression-free interval status", ""], ["Progression", "42"], ["Non-progression", "54"], ["Median time (days): 321", ""]], "row_count": 25, "column_count": 2, "numeric_cells": 19, "header_rows": 1, "locator": "section[3]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:41214700:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:bc961761813e3d64fb48ea34caf9f6207bfe3e1a4d04b3ad8a9ec009f0ae9405", "bytes": 336, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#Tab2", "version": null, "note": "siRNA sequences used in this study", "structure": {"pmcid": "PMC12604410", "section_index": 5, "section_title": "Vector construction and cell transfection", "row_count": 4, "column_count": 2}, "table": {"label": "Table 2", "caption": "siRNA sequences used in this study", "rows": [["siRNA", "target sequence (5’ to 3’)"], ["CFAP52−1", "GGAGCATAGCCAAGAGAGA"], ["CFAP52−2", "GGAGCCATTTTGCGATGGA"], ["CFAP52−3", "ACACCAGTTTCTCGTAGGA"]], "row_count": 4, "column_count": 2, "numeric_cells": 4, "header_rows": 1, "locator": "section[5]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:41214700:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:4e7849d87844f542153d4f9d9028ca81bab10d07181a582130e2dd2d38f3d9f7", "bytes": 491, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[1]#Tab3", "version": null, "note": "Primer sequences used in this study", "structure": {"pmcid": "PMC12604410", "section_index": 21, "section_title": "RNA extraction and quantitative real-time PCR (qRT-PCR)", "row_count": 5, "column_count": 3}, "table": {"label": "Table 3", "caption": "Primer sequences used in this study", "rows": [["Primer", "Forward sequence (5’ to 3’)", "Reverse sequence (5’ to 3’)"], ["CFAP52", "GCAACAACGTCTCCTGCTTG", "CTGTTTGGCACTCAGTTGGC"], ["PLAAT3", "CCCATTCCAGAGCCTAAGCC", "ACGATGGCCTTGTCAGTCAG"], ["PLA2G10", "TGGTTGCTTTTGTGGCTTGG", "GCATTTGTTCTCTGCCGGTC"], ["ACTB", "CACTCTTCCAGCCTTCCTTCC", "ACAGCACTGTGTTGGCGTAC"]], "row_count": 5, "column_count": 3, "numeric_cells": 4, "header_rows": 1, "locator": "section[21]/table-wrap[1]#Tab3"}}, {"id": "asset:table:pmid:41214700:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:6e733b65b1e14b733c9d1d498e9593c965d9d65824227c5e071f0915c073cd1b", "bytes": 1012, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[28]/table-wrap[1]#Tab4", "version": null, "note": "The result of univariate and multivariate Cox regression analyses", "structure": {"pmcid": "PMC12604410", "section_index": 28, "section_title": "Discovery of ESCC subgroups based on prognosis-related DNA methylation analysis", "row_count": 7, "column_count": 10}, "table": {"label": "Table 4", "caption": "The result of univariate and multivariate Cox regression analyses", "rows": [["Factor", "Overall survival", "Disease-specific survival", "Progression-free interval"], ["Univariate cox P value", "Univariate cox HR", "Multivariate cox P value", "Univariate cox P value", "Univariate cox HR", "Multivariate cox P value", "Univariate cox P value", "Univariate cox HR", "Multivariate cox P value"], ["Cluster (1 vs. 2 + 3)", "0.0042", "4.210", "0.0229", "0.0036", "7.268", "0.0136", "0.0063", "2.887", "0.0063"], ["Age (< 57 vs. > = 57)", "0.1721", "1.649", "-", "0.1336", "2.017", "-", "0.0716", "1.787", "-"], ["Alcohol history (No vs. Yes)", "0.1360", "2.237", "-", "0.1356", "3.061", "-", "0.0802", "2.167", "-"], ["Sex (female vs. male)", "0.0182", "5.803", "0.0912", "0.0554", "7.269", "-", "0.0810", "2.328", "-"], ["TNM stage (I + II vs. III + IV)", "0.0133", "2.478", "0.1223", "0.0042", "4.018", "0.0156", "0.1812", "1.541", "-"]], "row_count": 7, "column_count": 10, "numeric_cells": 38, "header_rows": 2, "locator": "section[28]/table-wrap[1]#Tab4"}}, {"id": "asset:table:pmid:41214700:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e3ebff4002f1298f3e9bd75ebdc41322cff1321b140bef1969a97b13e5cdd05e", "bytes": 705, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[29]/table-wrap[1]#Tab5", "version": null, "note": "The information of the overlapping monotonically changed genes", "structure": {"pmcid": "PMC12604410", "section_index": 29, "section_title": "Identification of the potential key genes involved in ESCC progression by analyzing TNM stage-related DNA methylation changes", "row_count": 5, "column_count": 7}, "table": {"label": "Table 5", "caption": "The information of the overlapping monotonically changed genes", "rows": [["CpG", "Position", "Gene", "CpG islandfeature", "Genomic region", "DNA methylation pattern", "Gene expression pattern"], ["cg12610887", "Chr17: 9,479,912", "CFAP52", "Shore", "Promoter", "Hypermethylation", "Upregulation"], ["cg25964007", "Chr17: 9,479,910", "CFAP52", "Shore", "Promoter", "Hypermethylation", "-"], ["cg09222023", "Chr3: 138,669,322", "FOXL2NB", "CpG island", "Gene body", "Hypermethylation", "Upregulation"], ["cg18414754", "Chr3: 138,668,832", "FOXL2NB", "CpG island", "Gene body", "Hypermethylation", "-"]], "row_count": 5, "column_count": 7, "numeric_cells": 10, "header_rows": 1, "locator": "section[29]/table-wrap[1]#Tab5"}}], "gaps": ["asset:source:pmid:41214700 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:41214700", "asset:table:pmid:41214700:1", "asset:table:pmid:41214700:2", "asset:table:pmid:41214700:3", "asset:table:pmid:41214700:4", "asset:table:pmid:41214700:5"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:41214700"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [], "target_providers": [], "agreement": false, "disagreements": [], "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": [{"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}]}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:dc04b355b588986b74d1014026bbfd0a77ef91c5839080b8cd1958f2fabe0ff3", "type": "sep_package", "label": "SEP v1 package for pmid:41214700"}], "activities": [{"id": "activity:conversion:pmid:41214700", "type": "conversion", "used": ["package:dc04b355b588986b74d1014026bbfd0a77ef91c5839080b8cd1958f2fabe0ff3"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:41214700", "parent_hash": "sha256:3792c0a6140a75b3f0751dbe8abe1d8c98d272fe6700e9365ed22d45e9327ebc", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:41214700 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:41214700' does not resolve to a declared asset", "targets"]}