Transcriptomic insights into GSDME-driven pyroptosis in head and neck cancer.

{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:41315579", "kind": "science-record", "revision": 2, "content_hash": "sha256:95e98faf2c5c7756e014cdabd42b27e020345b42e0ba81676a97139fe561b9c5", "created_at": "2026-11-01T10:25:54Z", "updated_at": "2026-11-01T14:01:51Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "Transcriptomic insights into GSDME-driven pyroptosis in head and neck cancer.", "doi": "10.1038/s41598-025-30182-3", "pmid": "41315579", "authors": null, "journal": "Scientific reports", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:41315579"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:41315579", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:41315579' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:41315579", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1038/s41598-025-30182-3", "sha256": "sha256:d932ef0e24ba138bafcbc42c4c0cd13eb0c9531f8c9d6325311c66bde8930fea", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1038/s41598-025-30182-3", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:41315579:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:65b7ce7eefab646614724936fde5f0d89573ac0afd38f2d01ea9cbf0c7d2c15a", "bytes": 1050, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#Tab1", "version": null, "note": "Baseline data table related to pyroptosis.", "structure": {"pmcid": "PMC12775021", "section_index": 3, "section_title": "Data sources", "row_count": 15, "column_count": 7}, "table": {"label": "Table 1", "caption": "Baseline data table related to pyroptosis.", "rows": [["Characteristic", "TCGA", "GSE65858"], ["Low score", "High score", "p", "Low score", "High score", "p"], ["n", "251", "250", "", "135", "135", ""], ["Gender, n (%)"], ["Female", "66 (13.2%)", "67 (13.4%)", "0.979", "26 (9.6%)", "21 (7.8%)", "0.521"], ["Male", "185 (36.9%)", "183 (36.5%)", "", "109 (40.4%)", "114 (42.2%)"], ["Stage, n (%)"], ["'–", "42 (8.4%)", "26 (5.2%)", "0.099", "", "", "0.755"], ["Stage I", "13 (2.6%)", "12 (2.4%)", "7 (2.6%)", "11 (4.1%)"], ["Stage II", "37 (7.4%)", "32 (6.4%)", "22 (8.1%)", "15 (5.6%)"], ["Stage III", "40 (8%)", "39 (7.8%)", "19 (7%)", "18 (6.7%)"], ["Stage IVA", "116 (23.2%)", "132 (26.3%)", "77 (28.5%)", "78 (28.9%)"], ["Stage IVB", "2 (0.4%)", "9 (1.8%)", "7 (2.6%)", "9 (3.3%)"], ["Stage IVC", "1 (0.2%)", "0 (0%)", "3 (1.1%)", "4 (1.5%)"], ["Age, median (IQR)", "60.62 (53.92, 68.53)", "62.03 (53.34, 69.66)", "0.231", "59.28 (54.86, 69.78)", "57.08 (51.24, 66.47)", "0.009"]], "row_count": 15, "column_count": 7, "numeric_cells": 49, "header_rows": 2, "locator": "section[3]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:41315579:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9f3df0a66c7714e12a0fd5901c4d607dc78bdf9c555e3da08c4e211caf32e399", "bytes": 511, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#Tab2", "version": null, "note": "Sequences of gene-specific primers used for real-time RT-qPCR.", "structure": {"pmcid": "PMC12775021", "section_index": 9, "section_title": "Quantitative realtime‑PCR validation", "row_count": 5, "column_count": 3}, "table": {"label": "Table 2", "caption": "Sequences of gene-specific primers used for real-time RT-qPCR.", "rows": [["Gene", "Forward primer (5′‑3′)", "Reverse primer (5′‑3′)"], ["NOD2", "CACCGTCTGGAATAAGGGTACT", "TTCATACTGGCTGACGAAACC"], ["NOD1", "ACTGAAAAGCAATCGGGAACTT", "CACACACAATCTCCGCATCTT"], ["GSDME", "ACATGCAGGTCGAGGAGAAGT", "TCAATGACACCGTAGGCAATG"], ["GAPDH", "Ctctgctcctcctgttcgac", "Ttaaaagcagccctggtgac"]], "row_count": 5, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[9]/table-wrap[1]#Tab2"}}], "gaps": ["asset:source:pmid:41315579 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:41315579", "asset:table:pmid:41315579:1", "asset:table:pmid:41315579:2"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:41315579"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [], "target_providers": [], "agreement": false, "disagreements": [], "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": [{"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}, {"provider": "minimax_alt", "model": null, "reason": "HTTP Error 429: Too Many Requests", "raw_response": null}]}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:5ad1d925c397e7acf57e6ecdaaddf3e8bb44b7be95a61dacf5bc859b5df7c50c", "type": "sep_package", "label": "SEP v1 package for pmid:41315579"}], "activities": [{"id": "activity:conversion:pmid:41315579", "type": "conversion", "used": ["package:5ad1d925c397e7acf57e6ecdaaddf3e8bb44b7be95a61dacf5bc859b5df7c50c"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:41315579", "parent_hash": "sha256:ffd567d9941829634f3c8169099a83de0203a8aaff3d180ea8708b66338e1df0", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:41315579 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "review.machine_critique.providers", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:41315579' does not resolve to a declared asset", "targets"]}