The subtype identification of colorectal cancer and construction of the risk model based on cholesterol synthesis-related genes to predict prognosis and guide immunotherapy.

{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:41511578", "kind": "science-record", "revision": 2, "content_hash": "sha256:9ac8e522f7759efad7c90797fdd70c22af0b20f7be695ae751c3d11eda9c1193", "created_at": "2026-11-01T10:25:54Z", "updated_at": "2026-11-01T14:01:53Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "The subtype identification of colorectal cancer and construction of the risk model based on cholesterol synthesis-related genes to predict prognosis and guide immunotherapy.", "doi": "10.1007/s00384-025-05067-6", "pmid": "41511578", "authors": null, "journal": "International journal of colorectal disease", "year": 2026, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "quantitative", "state": "complete", "target": {"value": 10.0, "unit": "genes", "tolerance": null, "source": "chars 1191-1269 of source sha256 c6a932a4b7150c3d8f27a54e73036392e871d485c366e1e98bd0f35322fa666f"}, "evidence": [{"asset": "source:pmid:41511578", "locator": "chars 1191-1269 of source sha256 c6a932a4b7150c3d8f27a54e73036392e871d485c366e1e98bd0f35322fa666f", "quote": "A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed."}]}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:41511578"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:41511578", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:41511578' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:41511578", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1007/s00384-025-05067-6", "sha256": "sha256:c6a932a4b7150c3d8f27a54e73036392e871d485c366e1e98bd0f35322fa666f", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1007/s00384-025-05067-6", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:41511578:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7bb1a4eafc1dcb0672df62e93d7c04b86b0242cc9804655d3cf91b65e8dfd475", "bytes": 351, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#Tab1", "version": null, "note": "qPCR primer sequences", "structure": {"pmcid": "PMC12789220", "section_index": 16, "section_title": "qRT-PCR", "row_count": 3, "column_count": 3}, "table": {"label": "Table 1", "caption": "qPCR primer sequences", "rows": [["Gene", "Forward primer (5′−3′)", "Reverse primer (5′−3′)"], ["EEF1A2", "GGCCACCTCATCTACAAATG", "TCGAACTTCCAGAGGGAGAT"], ["GAPDH", "CGGGAAGCTTGTCATCAAT", "TCTCCATGGTGGTGAAGA"]], "row_count": 3, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[16]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:41511578:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9c42e09436b00121691b68bfda7de252cdf98adea47ec425c7598449aa61797d", "bytes": 387, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[1]#Tab2", "version": null, "note": "Comparison of the distribution relationship between clustering and CMS subtypes", "structure": {"pmcid": "PMC12789220", "section_index": 23, "section_title": "Consensus cluster analysis and construction of PPI network based on CSRGs", "row_count": 4, "column_count": 5}, "table": {"label": "Table 2", "caption": "Comparison of the distribution relationship between clustering and CMS subtypes", "rows": [["Cluster", "CMS1", "CMS2", "CMS3", "CMS4"], ["1", "20.4%", "26.4%", "13.0%", "40.3%"], ["2", "18.8%", "45.1%", "23.3%", "12.8%"], ["Total", "19.8%", "33.5%", "16.9%", "29.8%"]], "row_count": 4, "column_count": 5, "numeric_cells": 14, "header_rows": 1, "locator": "section[23]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:41511578:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:fa18deb03b0c9dbbb4ce21fb548d0a46f9da487fd9d57a82f293627983f2e898", "bytes": 345, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[2]#Tab3", "version": null, "note": "Comparison of the distribution relationship between clustering and MSI", "structure": {"pmcid": "PMC12789220", "section_index": 23, "section_title": "Consensus cluster analysis and construction of PPI network based on CSRGs", "row_count": 4, "column_count": 4}, "table": {"label": "Table 3", "caption": "Comparison of the distribution relationship between clustering and MSI", "rows": [["Cluster", "MSI-H", "MSI-L", "MSS"], ["1", "12.0%", "12.0%", "75.9%"], ["2", "9.8%", "5.3%", "85.0%"], ["Total", "11.2%", "9.5%", "79.4%"]], "row_count": 4, "column_count": 4, "numeric_cells": 11, "header_rows": 1, "locator": "section[23]/table-wrap[2]#Tab3"}}, {"id": "asset:table:pmid:41511578:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ebd3d91384ba879aa0a0b41b3b6fa37528cc85b88f0b4716b28435dfd045e245", "bytes": 580, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[3]#Tab4", "version": null, "note": "Post-adjustment logistic regression analysis was used to evaluate the relationship between CMS subtypes and MSI status and clustering classification", "structure": {"pmcid": "PMC12789220", "section_index": 23, "section_title": "Consensus cluster analysis and construction of PPI network based on CSRGs", "row_count": 7, "column_count": 3}, "table": {"label": "Table 4", "caption": "Post-adjustment logistic regression analysis was used to evaluate the relationship between CMS subtypes and MSI status and clustering classification", "rows": [["Term", "OR (95% CI)", "P-value"], ["(Intercept)", "0.790(0.390–1.570)", "0.496"], ["CMS2", "1.360(0.630–2.970)", "0.435"], ["CMS3", "1.500(0.660–3.420)", "0.330"], ["CMS4", "0.270(0.120–0.620)", "0.002"], ["MSI-H", "0.640(0.250–1.560)", "0.330"], ["MSI-L", "0.500(0.180–1.240)", "0.152"]], "row_count": 7, "column_count": 3, "numeric_cells": 13, "header_rows": 1, "locator": "section[23]/table-wrap[3]#Tab4"}}, {"id": "asset:table:pmid:41511578:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ec94dd11eb232ffcd76c44ca93d910b7ff2378d8177a291af34a4847074a6f97", "bytes": 329, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[24]/table-wrap[1]#Tab5", "version": null, "note": "Time-dependent AUC after bootstrap optimism bias correction", "structure": {"pmcid": "PMC12789220", "section_index": 24, "section_title": "The construction and validation of CSRRS as well as the assessment of its independent prognostic value", "row_count": 4, "column_count": 3}, "table": {"label": "Table 5", "caption": "Time-dependent AUC after bootstrap optimism bias correction", "rows": [["Time (year)", "AUC", "95%CI"], ["1", "0.713", "0.591–0.833"], ["3", "0.743", "0.644–0.842"], ["5", "0.675", "0.514–0.824"]], "row_count": 4, "column_count": 3, "numeric_cells": 10, "header_rows": 1, "locator": "section[24]/table-wrap[1]#Tab5"}}], "gaps": ["asset:source:pmid:41511578 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:41511578", "asset:table:pmid:41511578:1", "asset:table:pmid:41511578:2", "asset:table:pmid:41511578:3", "asset:table:pmid:41511578:4", "asset:table:pmid:41511578:5"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:41511578"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "full-text-reading-v1", "prompt_hash": "ac0b236318f3cfcee32bcdfbb2b3a0b3560cf68bb6ffb570c4049f16c6bcb3d2", "source_hash": "c6a932a4b7150c3d8f27a54e73036392e871d485c366e1e98bd0f35322fa666f", "raw_response_sha256": "sha256:ee03d185035d5bb70dcc02883d11e2f4e58b7a35b0e81b9c1ea64dbd17577ac0", "raw_response_chars": 5950}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "full-text-reading-v1", "prompt_hash": "62940d86060f00badfbdf2434a0632680552b6664d2a5e693edc7b100b90f7b9", "source_hash": "c6a932a4b7150c3d8f27a54e73036392e871d485c366e1e98bd0f35322fa666f", "raw_response_sha256": "sha256:6bc14cb238994dad334ecf8b51f129ec0f9a5cbf13fe01c8e19c6aabcb20ff67", "raw_response_chars": 65453}], "target_providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "replication-target-v2", "prompt_hash": "ca353d4ff266e6952f9a30ced80fb03561a885ae59d40bf542737cdaefbae7ef", "source_hash": "c6a932a4b7150c3d8f27a54e73036392e871d485c366e1e98bd0f35322fa666f", "raw_response": "{\"parent_value\":10,\"unit\":\"genes\",\"evidence\":\"A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.\",\"target_result\":\"A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.\",\"number_stated\":true}", "reading": {"parent_value": 10, "unit": "genes", "evidence": "A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.", "target_result": "A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.", "number_stated": true, "source_locator": "chars 1191-1269 of source sha256 c6a932a4b7150c3d8f27a54e73036392e871d485c366e1e98bd0f35322fa666f"}, "recorded_at": "2026-10-31T15:27:41.626278+00:00"}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "replication-target-v2", "prompt_hash": "a0583402ffb03c9b3344d96b605e3cec9e492b6b1d2533133808490a9db7d720", "source_hash": "c6a932a4b7150c3d8f27a54e73036392e871d485c366e1e98bd0f35322fa666f", "raw_response": "<think>We need answer JSON only. Need identify single numerical result headline for main finding / registered target. Source abstract says 10-gene signature constructed. Is that headline numerical result? Likely yes: \"A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.\" Replication target headline numerical result paper states. Need value 10, unit perhaps \"genes\" because printed wording 10-gene. Evidence exact contiguous quote. Could perhaps target is main finding as risk model? No performance metric (AUC, HR) absent. Headline numerical result likely 10-gene CSRS. Need report headline number only and unit paper prints. Unit maybe \"genes\". Evidence exact sentence. target_result likely \"A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.\" Number stated true, parent_value 10, unit \"genes\". Ensure JSON valid unicode. They insist evidence exact contiguous quotation contains number; quote whole clause attribution. Could evidence be \"A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.\" Exact source. Target_result same perhaps. \"headline number only\" perhaps target_result textual. Schema asks. Need not quote larger. Use exact sentence.\n\nPotential ambiguity: 2 subtypes, 10 gene risk signature. Registered target \"headline numerical result the paper states for its main finding\". Main finding could 10 gene signature. \"headline numerical result\" likely extraction benchmark where source lacks clear metric? They may expect 10 and genes. Let's deeply assess.\n\nPaper title: subtype identification and risk model. Abstract results: divided into two subtypes; A 10-gene signature constructed; high group poorer prognosis; EEF1A2 etc. The replication of registered target has to reproduce \"the headline numerical result paper states for its main finding\". Maybe target is specifically main finding and wants a singular number. Could be 10-gene signature. Other headline number: two subtypes. Which is headline? Wording says \"single numerical result that a replication of the registered target has to reproduce.\" Registered target generic. \"headline numerical result the paper itself states for the registered target\" We need identify main result likely number of genes in risk signature. The title \"construction of risk model based on cholesterol synthesis-related genes\"; abstract explicitly \"A 10-gene ... Risk Signature ... was constructed.\" This is likely intended.\n\nUnit exact printed? \"10-gene\" means unit could be \"genes\". They ask \"unit must be the unit the paper prints.\" The printed unit is \"gene\" adjectivally, likely unit \"genes\". Maybe value 10, unit \"gene\". Need decide. Usually these tasks expect numerical value and unit as textual, e.g. 10 genes. We can use \"genes\". Evidence exact sentence.\n\ntarget_result maybe \"The study constructed a 10-gene Cholesterol Synthesis-related Risk Signature (CSRS).\" This paraphrases perhaps okay in field. Evidence exact. \"Report headline number only\" perhaps target_result should simply describe. JSON.\n\nLet's ensure no extra properties.</think>\n\n{\"parent_value\":10,\"unit\":\"genes\",\"evidence\":\"A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.\",\"target_result\":\"A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.\",\"number_stated\":true}", "reading": {"parent_value": 10, "unit": "genes", "evidence": "A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.", "target_result": "A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.", "number_stated": true, "source_locator": "chars 1191-1269 of source sha256 c6a932a4b7150c3d8f27a54e73036392e871d485c366e1e98bd0f35322fa666f"}, "recorded_at": "2026-10-31T15:27:45.607065+00:00"}], "agreement": false, "disagreements": {"target_result": {"minimax": "A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed.", "minimax_alt": "A 10-gene Cholesterol Synthesis-related Risk Signature (CSRS) was constructed for CRC prognosis, and patients in the high-CSRS group had a poorer prognosis.", "decisive": false}, "analysis_methods": {"minimax": ["univariate Cox regression analysis", "consensus clustering", "PPI network analysis", "regression analysis", "ROC curve analysis", "Kaplan–Meier survival analysis", "differential expression analysis", "GO enrichment analysis", "KEGG enrichment analysis", "immune infiltration analysis", "drug sensitivity analysis", "mutational waterfall plot analysis"], "minimax_alt": ["univariate Cox regression analysis", "consensus clustering using the ConsensusClusterPlus R package", "differential expression analysis using the edgeR package", "PPI network analysis using STRING", "multivariate logistic regression analysis", "ROC curve analysis", "Kaplan–Meier survival analysis", "KEGG and Gene Ontology enrichment analysis using clusterProfiler", "ssGSEA using the GSVA R package", "xcell algorithm", "immunophenoscore (IPS) and Tumor Immune Dysfunction and Exclusion (TIDE) analysis", "mutation analysis using maftools", "CellMiner and GDSC-related drug-sensitivity analysis", "oncoPredict algorithm", "t-test for comparisons between two groups in wet experiments"], "decisive": false}, "statistical_method": {"minimax": "univariate Cox regression analysis", "minimax_alt": "Univariate Cox regression analysis for prognostic gene screening and Kaplan–Meier survival analysis for the prognosis comparison", "decisive": true}}, "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": []}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:0b3890d25f030fdb5988c24039945d370257e9edfef41683b3981e9bda8ff8b1", "type": "sep_package", "label": "SEP v1 package for pmid:41511578"}], "activities": [{"id": "activity:conversion:pmid:41511578", "type": "conversion", "used": ["package:0b3890d25f030fdb5988c24039945d370257e9edfef41683b3981e9bda8ff8b1"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:minimax", "type": "model", "label": "minimax"}, {"id": "agent:minimax_alt", "type": "model", "label": "minimax_alt"}, {"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:41511578", "parent_hash": "sha256:d884fe490c724e835a2a1351f2501bb30bf659ba6d466ffc7c48f423ff608042", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:41511578 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:41511578' does not resolve to a declared asset", "targets"]}