← All .science files
pmid:25678762
Gene expression changes during retinal development and rod specification.
Fiona C Mansergh · Matthew Carrigan · Karsten Hokamp · G Jane Farrar
Molecular vision · 2015
Paper
partial
Experiment
complete
Data
partial
Analysis
complete
Execution
absent
Execution evidence has not yet been added to this .science file. Explore its methods, data and open questions to plan the next step.
Record details sci_version · id · kind · revision · content_hash · schema · created_at · updated_at · generator
paper object · 10 fields
authors array · 4 items
claims array · 2 items
[0] object · 6 fields
gaps array · 1 item
experiment object · 8 fields
steps array · 3 items
[0] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[1] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[2] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
materials array · 0 items
instruments array · 0 items
reagents array · 0 items
conditions object · 0 fields
gaps array · 0 items
data object · 3 fields
assets array · 9 items
[0] object · 15 fields
structure object · 4 fields
[1] object · 15 fields
structure object · 15 fields
sample_accessions array · 20 items
[2] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 47 items
[0] array · 4 items
[1] array · 4 items
[2] array · 4 items
[3] array · 4 items
[4] array · 4 items
[5] array · 4 items
[6] array · 4 items
[7] array · 4 items
[8] array · 4 items
[9] array · 4 items
[10] array · 4 items
[11] array · 4 items
[12] array · 4 items
[13] array · 4 items
[14] array · 4 items
[15] array · 4 items
[16] array · 4 items
[17] array · 4 items
[18] array · 4 items
[19] array · 4 items
[20] array · 4 items
[21] array · 4 items
[22] array · 4 items
[23] array · 4 items
[24] array · 4 items
[25] array · 4 items
[26] array · 4 items
[27] array · 4 items
[28] array · 4 items
[29] array · 4 items
[30] array · 4 items
[31] array · 4 items
[32] array · 4 items
[33] array · 4 items
[34] array · 4 items
[35] array · 4 items
[36] array · 4 items
[37] array · 4 items
[38] array · 4 items
[39] array · 4 items
[40] array · 4 items
[41] array · 4 items
[42] array · 4 items
[43] array · 4 items
[44] array · 4 items
[45] array · 4 items
[46] array · 4 items
[3] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 42 items
[0] array · 4 items
[1] array · 6 items
[2] array · 6 items
[3] array · 6 items
[4] array · 6 items
[5] array · 6 items
[6] array · 6 items
[7] array · 6 items
[8] array · 6 items
[9] array · 6 items
[10] array · 6 items
[11] array · 6 items
[12] array · 6 items
[13] array · 6 items
[14] array · 5 items
[15] array · 5 items
[16] array · 6 items
[17] array · 5 items
[18] array · 6 items
[19] array · 6 items
[20] array · 6 items
[21] array · 6 items
[22] array · 6 items
[23] array · 6 items
[24] array · 6 items
[25] array · 5 items
[26] array · 5 items
[27] array · 6 items
[28] array · 5 items
[29] array · 5 items
[30] array · 6 items
[31] array · 5 items
[32] array · 6 items
[33] array · 6 items
[34] array · 5 items
[35] array · 6 items
[36] array · 5 items
[37] array · 6 items
[38] array · 6 items
[39] array · 5 items
[40] array · 6 items
[41] array · 6 items
[4] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 49 items
[0] array · 4 items
[1] array · 5 items
[2] array · 5 items
[3] array · 5 items
[4] array · 5 items
[5] array · 5 items
[6] array · 5 items
[7] array · 5 items
[8] array · 5 items
[9] array · 5 items
[10] array · 5 items
[11] array · 5 items
[12] array · 5 items
[13] array · 5 items
[14] array · 5 items
[15] array · 5 items
[16] array · 5 items
[17] array · 5 items
[18] array · 5 items
[19] array · 5 items
[20] array · 5 items
[21] array · 5 items
[22] array · 5 items
[23] array · 5 items
[24] array · 5 items
[25] array · 5 items
[26] array · 5 items
[27] array · 5 items
[28] array · 5 items
[29] array · 5 items
[30] array · 5 items
[31] array · 5 items
[32] array · 5 items
[33] array · 5 items
[34] array · 5 items
[35] array · 5 items
[36] array · 5 items
[37] array · 5 items
[38] array · 5 items
[39] array · 5 items
[40] array · 5 items
[41] array · 5 items
[42] array · 5 items
[43] array · 5 items
[44] array · 5 items
[45] array · 5 items
[46] array · 5 items
[47] array · 5 items
[48] array · 5 items
[5] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 37 items
[0] array · 3 items
[1] array · 3 items
[2] array · 3 items
[3] array · 3 items
[4] array · 3 items
[5] array · 3 items
[6] array · 3 items
[7] array · 3 items
[8] array · 3 items
[9] array · 3 items
[10] array · 3 items
[11] array · 3 items
[12] array · 3 items
[13] array · 3 items
[14] array · 3 items
[15] array · 3 items
[16] array · 3 items
[17] array · 3 items
[18] array · 3 items
[19] array · 3 items
[20] array · 3 items
[21] array · 3 items
[22] array · 3 items
[23] array · 3 items
[24] array · 3 items
[25] array · 3 items
[26] array · 3 items
[27] array · 3 items
[28] array · 3 items
[29] array · 3 items
[30] array · 3 items
[31] array · 3 items
[32] array · 3 items
[33] array · 3 items
[34] array · 3 items
[35] array · 3 items
[36] array · 3 items
[6] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 35 items
[0] array · 3 items
[1] array · 6 items
[2] array · 6 items
[3] array · 6 items
[4] array · 6 items
[5] array · 6 items
[6] array · 6 items
[7] array · 6 items
[8] array · 6 items
[9] array · 6 items
[10] array · 6 items
[11] array · 6 items
[12] array · 6 items
[13] array · 6 items
[14] array · 6 items
[15] array · 6 items
[16] array · 6 items
[17] array · 6 items
[18] array · 6 items
[19] array · 6 items
[20] array · 6 items
[21] array · 6 items
[22] array · 6 items
[23] array · 6 items
[24] array · 6 items
[25] array · 6 items
[26] array · 6 items
[27] array · 6 items
[28] array · 6 items
[29] array · 6 items
[30] array · 6 items
[31] array · 6 items
[32] array · 6 items
[33] array · 6 items
[34] array · 6 items
[7] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 7 items
[0] array · 4 items
[1] array · 4 items
[2] array · 4 items
[3] array · 4 items
[4] array · 4 items
[5] array · 4 items
[6] array · 4 items
[8] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 9 items
[0] array · 4 items
[1] array · 4 items
[2] array · 4 items
[3] array · 4 items
[4] array · 4 items
[5] array · 4 items
[6] array · 4 items
[7] array · 4 items
[8] array · 4 items
gaps array · 2 items
analysis object · 4 fields
methods array · 1 item
[0] object · 10 fields
dsl_operations array · 3 items
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 1 item
targets array · 0 items
gaps array · 0 items
capability object · 3 fields
requirements array · 1 item
[0] object · 6 fields
assay_families array · 9 items
gaps array · 0 items
readiness object · 8 fields
axes object · 3 fields
method object · 5 fields
required_operations array · 3 items
missing_operations array · 0 items
capability object · 4 fields
data object · 6 fields
accessions array · 1 item
resolved_accessions array · 1 item
statements array · 1 item
can_run object · 3 fields
dsl_operations array · 3 items
assets array · 9 items
steps array · 1 item
must_build object · 5 fields
dsl_operations array · 0 items
converters array · 0 items
readers array · 0 items
capabilities array · 0 items
data_gaps array · 1 item
gaps array · 0 items
review object · 5 fields
machine_critique object · 5 fields
reader object · 5 fields
evidence_check object · 2 fields
usage object · 0 fields
stages array · 1 item
[0] object · 4 fields
gaps array · 3 items
provenance object · 7 fields
entities array · 3 items
activities array · 3 items
[0] object · 4 fields
used array · 3 items
[0] object · 3 fields
[1] object · 3 fields
[2] object · 3 fields
[1] object · 4 fields
agents array · 2 items
lineage object · 4 fields
gaps array · 7 items
assays array · 5 items
[0] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 1 item
[1] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 2 items
[2] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 3 items
[3] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 1 item
[4] object · 11 fields
required_operations array · 3 items
source_hashes object · 1 field
evidence array · 1 item
Complete file
{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:25678762", "kind": "science-record", "revision": 8, "content_hash": "sha256:b1b37529a04e8f1d966b6fc2006efc8bab02d777efdcc8e934b1e70ae4c0d1b4", "created_at": "2026-11-01T15:40:07Z", "updated_at": "2026-11-01T22:42:11Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "partial", "title": "Gene expression changes during retinal development and rod specification.", "doi": null, "pmid": "25678762", "authors": ["Fiona C Mansergh", "Matthew Carrigan", "Karsten Hokamp", "G Jane Farrar"], "journal": "Molecular vision", "year": 2015, "abstract": "PURPOSE: Retinitis pigmentosa (RP) typically results from individual mutations in any one of >70 genes that cause rod photoreceptor cells to degenerate prematurely, eventually resulting in blindness. Gene therapies targeting individual RP genes have shown efficacy at clinical trial; however, these therapies require the surviving photoreceptor cells to be viable and functional, and may be economically feasible for only the more commonly mutated genes. An alternative potential treatment strategy, particularly for late stage disease, may involve stem cell transplants into the photoreceptor layer of the retina. Rod progenitors from postnatal mouse retinas can be transplanted and can form photoreceptors in recipient adult retinas; optimal numbers of transplantable cells are obtained from postnatal day 3-5 (P3-5) retinas. These cells can also be expanded in culture; however, this results in the loss of photoreceptor potential. Gene expression differences between postnatal retinas, cultured retinal progenitor cells (RPCs), and rod photoreceptor precursors were investigated to identify gene expression patterns involved in the specification of rod photoreceptors.\nMETHODS: Microarrays were used to investigate differences in gene expression between cultured RPCs that have lost photoreceptor potential, P1 retinas, and fresh P5 retinas that contain significant numbers of transplantable photoreceptors. Additionally, fluorescence-activated cell sorting (FACS) sorted Rho-eGFP-expressing rod photoreceptor precursors were compared with Rho-eGFP-negative cells from the same P5 retinas. Differential expression was confirmed with quantitative polymerase chain reaction (q-PCR).\nRESULTS: Analysis of the microarray data sets, including the use of t-distributed stochastic neighbor embedding (t-SNE) to identify expression pattern neighbors of key photoreceptor specific genes, resulted in the identification of 636 genes differentially regulated during rod specification. Forty-four of these genes when mutated have previously been found to cause retinal disease. Although gene function in other tissues may be known, the retinal function of approximately 61% of the gene list is as yet undetermined. Many of these genes' promoters contain binding sites for the key photoreceptor transcription factors Crx and Nr2e3; moreover, the genomic clustering of differentially regulated genes appears to be non-random.\nCONCLUSIONS: This study aids in understanding gene expression differences between rod photoreceptor progenitors versus cultured RPCs that have lost photoreceptor potential. The results provide insights into rod photoreceptor development and should expedite the development of cell-based treatments for RP. Furthermore, the data set includes a large number of retinopathy genes; less-well-characterized genes within this data set are a resource for those seeking to identify novel retinopathy genes in patients with RP (GEO accession: GSE59201).", "claims": [{"id": "claim-method", "statement": "Expression across different conditions, together with associated significance tests, were performed using R and Limma [48,49].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:25678762", "locator": "sections[10] \"Expression analysis\" paragraph 2", "quote": "Expression across different conditions, together with associated significance tests, were performed using R and Limma [48,49]."}], "state": "complete"}, {"id": "claim-data-access", "statement": "All data have been submitted to GEO ([55]) in accordance with MIAMI standards [56,57]. The GEO accession number for this data set is GSE59201.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:25678762", "locator": "sections[15] \"GEO\" paragraph 2", "quote": "All data have been submitted to GEO ([55]) in accordance with MIAMI standards [56,57]. The GEO accession number for this data set is GSE59201."}], "state": "complete"}], "gaps": ["doi"]}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:25678762"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE59201"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE59201"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:25678762", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": null, "sha256": "sha256:effb194f3ca02841f02f9ee686a64342aa68bb5c3e21fa25b5e230801872b293", "bytes": 56748, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "25678762", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC4301594", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE59201", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE59201", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE59201", "version": null, "note": "All data have been submitted to GEO ([55]) in accordance with MIAMI standards [56,57]. The GEO accession number for this data set is GSE59201.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data have been submitted to GEO ([55]) in accordance with MIAMI standards [56,57]. The GEO accession number for this data set is GSE59201.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1430377", "GSM1430378", "GSM1430379", "GSM1430380", "GSM1430381", "GSM1430382", "GSM1430383", "GSM1430384", "GSM1430385", "GSM1430386", "GSM1430387", "GSM1430388", "GSM1430389", "GSM1430390", "GSM1430391", "GSM1430392", "GSM1430393", "GSM1430394", "GSM1430395", "GSM1430396"], "sample_count": 20, "group_sizes": null, "group_sizes_basis": null, "platform": "8321", "taxon": "Mus musculus", "title": "Gene expression changes during retinal development and rod specification.", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:25678762:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:129b13c30fad22bbaeb705e501606a4956a9b27c349e91412fd7bb2916eaf0b7", "bytes": 3317, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#t1", "version": null, "note": "Primer sequences for primers used in q-PCR.", "structure": {"pmcid": "PMC4301594", "section_index": 16, "section_title": "Q-PCR", "row_count": 47, "column_count": 4}, "table": {"label": "Table 1", "caption": "Primer sequences for primers used in q-PCR.", "rows": [["Primer name", "Sequence", "Primer name", "Sequence"], ["A530058N18RikR:", "CCACCTTGACACAGGCTGGA", "Lrp4F", "TTCCAGTGCTGGTGTGAAGC"], ["A530058N18RikF:", "CCGCAGGAGGAACAGACACA", "Lrp4R", "CGGTGATGAAAGTCGAGGGC"], ["Arr3F", "CTGGATGGCAAACTCAAGCA", "MitfF", "GATGGACGATGCCCTCTCAC"], ["Arr3R", "AGGAGATGGCTTTGGATGGA", "MitfR", "CTGGGCTACTGATAAAGCACGAA"], ["B9d1F", "GTACGGCAAGCACTGGTGTG", "Neurog2F", "GCAGCGCATCAAGAAGACCC"], ["B9d1R", "GAGAGAGGGGCACATGCACT", "Neurog2R", "GTAATTGTGGGCGAAGCGCA"], ["BC022687F", "AGGGTCATGTCCTGGAAGGT", "NfiaF", "TCACCGACCTACTCGACACC"], ["BC022687R", "AGGTAATCAGGCTGCCCTGT", "NfiaR", "GGTTGAGGTTGCGTCCATGT"], ["BC027072F", "GTCCCGCTCAGACTGGGAAT", "Nr2e3F", "TTGGGAAATTGCTCCTCCTG"], ["BC027072R", "CCCTGCAGTTCTGGGACTCT", "Nr2e3R", "CCTGTGGACACTTGGCACTC"], ["B-actin F", "CCACCATGTACCCAGGCATT", "Nr6a1F", "TCCTGCTCTCCTCCCTCACA"], ["B-actin R", "ACAGTGAGGCCAGGATGGAG", "Nr6a1R", "GCATGCGTACTCCTCGTTGC"], ["Bin1F", "GGCGATGTGGTGTTGGTGAT", "NrlF", "ATGCAAGTGGATTGGAGGAG"], ["Bin1R", "TCTTCACACTCGGGAAGGCT", "NrlR", "CATGGCAACTGTGAGACCTG"], ["Cdk2ap2F", "TCCCTACAGCCGGGAGTGTC", "NsfF", "TCCCTGCAGATGGATCCTGA"], ["Cdk2ap2R", "ACAGCAGGTCCGTGTAGGTG", "NsfR", "CATCTGCACCTTGGTCGCTT"], ["Chx10F:", "AAGGAGCCATGTTGGACTGA", "Otx2F", "GGTCCATCAACCAGCAACCT"], ["Chx10R:", "GCCTGGGAATACAGGAGCAG", "Otx2R", "ACACCGGATCACCTCTGCTT"], ["Cnga1F", "TTGGGAGAAAGAGTCGTCTG", "Pax6F", "GAGAAATGGCGGTTAGAAGCA"], ["Cnga1R", "GAACATCGGTGGGGAAGAAA", "Pax6R", "CAACCACATGAGCAACACAGA"], ["CrxF", "TCTTCCGTAAAGGTGCTGAGA", "Plagl1F", "CGAAGGCTGAGTGTGGCAAA"], ["CrxR", "TGCTGGGATTATGACCATTGA", "Plagl1R", "TCGTCACACGCGTAGGAGAT"], ["Dleu2F", "CTGGAGAGCTCGCCCAGAC", "Ppargc1aF", "TACACCTGTGACGCTTTCGC"], ["Dleu2R", "CCAATGCATTACATGGGCATTCA", "Ppargc1aR", "TCTTGGTGGAAGCAGGGTCA"], ["Eno2F", "AGGAGTTCATGATCCTCCCAGT", "PtgdsF", "GCATCCACTCCGTGTCAGTG"], ["Eno2R", "TGGCTTCCTTCACCAGCTCC", "PtgdsR", "CTGGGCCTTGCTAAAGGTGG"], ["Epb4.1l2F", "GTCGGTCACAAGGGTGGTAG", "RhoF", "CTGAGGGCATGCAATGTTCA"], ["Epb4.1l2R", "TGGAGTAGTGGTACGGCGTT", "RhoR", "CATAGCAGAAGAAGATGACG"], ["Fgf9F", "GAAAGACCACAGCCGCTTCG", "RtbdnF", "TGGAGAGAGAGGCTGTGAGC"], ["Fgf9R", "AGAGGTTGGAAGAGTAGGTGTTGT", "RtbdnR", "TGGAGACGTTGAGGCAGTGA"], ["Fgf13F", "CTACCGTCAGCAGCAATCCG", "SamD11F", "CTAGGGCCTGCCCTCAAGAT"], ["Fgf13R", "CCAGATCGGGAGAACTCCGT", "SamD11R", "CCTTCATACGGGGAGGTGGT"], ["Fgf15F", "GCGGACGGCAAGATATACGG", "Sema7aF", "GGCTTCTGCTGGTGTTCTGG"], ["Fgf15R", "TCCTGGAGCTGTTCTCTGGG", "Sema7aR", "CGGCTCATGGAAAAGCACGG"], ["Foxo1F", "GCCACTCGCGGGACAG", "Shisa2F", "CAGACCGAGAAGGCCCAGA"], ["Foxo1R", "AGTAGGGCACGCTCTTCACC", "Shisa2R", "TCTGCTGGGGATCCTGCTTT"], ["Glo1F", "TGGGATTGCCGTTCCTGATG", "Slc25a33F", "CTCCTGCATCGCTTACCCAC"], ["Glo1R", "CCTCAAAGGCACATTCTCCCG", "Slc25a33R", "CAGTCCTCGGTAGAAGGCGA"], ["Igsf9F", "GGCCAGGGTCAGGTGCAA", "Sox2F", "CTAGACTCCGGGCGATGAAA"], ["Igsf9R", "AGTTGACTGTACTGTTGCTGGG", "Sox2R", "TGCCTTAAACAAGACCACGAA"], ["Kcnk1F", "CGTGTTCTCTGTGCTGGAGG", "Stx3F", "GGATGAAGGACCGGCTGGAG"], ["Kcnk1R", "CAACCAGCATGGCGATGAGT", "Stx3R", "AGCCGTGTTTCCTCGATCTCA"], ["Kif9F", "CATGACAGGGGCAACGGAGA", "Vopp1F", "GCCACCACTCATTGAGGAGC"], ["Kif9R:", "AGGGCAGAGTGGACAGGAGA", "Vopp1R", "GCCTCCGTGAGGTGAATTGG"], ["Klc3F", "AACAACCTGGCCTCAGCCTA", "Vsx2F", "CTGTGCCCCATGGCTACTG"], ["Klc3R", "TCCTCGCCTGATGGATTCCC", "Vsx2R", "CCGTTCCTCCTGCTCCATCT"]], "row_count": 47, "column_count": 4, "numeric_cells": 18, "header_rows": 1, "locator": "section[16]/table-wrap[1]#t1"}}, {"id": "asset:table:pmid:25678762:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9d59f734d61fd19f508e938af78e24ff97a147f0aa8c3eede629b043fe4474f0", "bytes": 3424, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#t2", "version": null, "note": "Genes upregulated in rods, as determined by upregulation in FACSed Rho-eGFP positive cells and expression changes in at least 2/3 other comparisons (RPC versus pn1, RPC versus pn5, pn1 versus pn5).", "structure": {"pmcid": "PMC4301594", "section_index": 17, "section_title": "Results", "row_count": 42, "column_count": 6}, "table": {"label": "Table 2", "caption": "Genes upregulated in rods, as determined by upregulation in FACSed Rho-eGFP positive cells and expression changes in at least 2/3 other comparisons (RPC versus pn1, RPC versus pn5, pn1 versus pn5).", "rows": [["Upregulated genes.", "", "Upregulated + Neighbours", ""], ["0610010O12Rik", "Epn2", "Pax7", "Abcg4 [32]", "Lztfl1", "Samd11 [31,35]"], ["Abhd5", "Eps8 [32]", "Pcdh15 [16,32,38,42]", "Acsl1", "Mak [31,34,35]", "Sec14l2 [34]"], ["Abhd14b", "Fam107b", "Pias3 [31,34]", "Agtpbp1 [31,32]", "Mdm1", "Sema7a [16]"], ["Acadvl", "Fam60a", "Pip4k2c", "Aipl1 [35-38]", "Mpp4 [32,35]", "Shisa2 [42]"], ["Aco2 [31]", "Galnt4", "Pla2g5", "Amy1", "Mrpl49 [31]", "Slc12a5"], ["Ahr [37]", "Galt", "Pla2r1 [16,32,42]", "Ankrd33 [31,37]", "Mtfp1", "Slc19a1"], ["Akap1 [31]", "Gdpd5", "Plagl2 [32],", "Arl6 [38],", "Mthfr", "Slc25a33"], ["Aldoc", "Glmn [31]", "Plekha2 [16]", "Bbs9 [16,32,38],", "Ndrg1 [31,37]", "Slc27a2"], ["Alpl", "Hif1a [32]", "Plekhf2", "BC027072 [35],", "Nr2e3 [31,34-36,38,40]", "Snap25 [16,31,36,38]"], ["Apobec2", "Hsp90aa1 [31]", "Plxna2", "C1ql3", "Nrl [31]", "Spint2"], ["Arhgap24", "Hspa41 [31]", "Ppargc1a", "Cdhr1 [34]", "Nsf", "St6galnac2"], ["Arl4a", "Htra1 [38]", "Ppargc1b [32]", "Cdk5r2", "Nxnl2 [35]", "Stx3 [31,42]"], ["BC022687", "Ift80", "Ppp2r5c", "Cep290 [38]", "Pdc 31 [30,36,38]", "Stxbp1 [31]"], ["Bcar3", "Ift88 [31]", "Prr14", "Chga [31]", "Pde6b [16,30,31,34-38,40]"], ["Bicd2", "Laptm4b", "Rbpms", "Ckmt1 [32]", "Pde6g [16,31,32,34-36,38,40]"], ["Bin1 [33]", "Lass4 [31]", "Reep6 [36,40]", "Clstn1 [16,42]", "Pitpnm1 [31]", "Syngr1"], ["C1qtnf4", "Lmo1", "Rpl31", "Cnga1 [16,34,36,38,40,42]", "Podxl [16,31,34,42]"], ["Cadm1", "Lrp4 [16,34,42]", "Scamp5", "Cplx3", "Ppef2", "Sys1"], ["Camk1d [31]", "Madd", "Sh3bgrl2", "Crx [33,35,38,40]", "Prickle1 [31]", "Tbc1d8 [34]"], ["Camkk1", "Map4k3 [31]", "Slc25a5 [31],", "Crxos1 [39]", "Prkab1 [31,32]", "Tob2"], ["Capn7", "Mat2a [31]", "Slc44a1", "Dalrd3", "Prom1 [16,31,34,38,40,42]", "Ttc8 [16,38,40]"], ["Ccdc72", "Me1", "Slc4a7", "Doc2b [31]", "Ptp4a3 [16,31]", "Tub [31,32]"], ["Ccng1 [31]", "Med16", "Snca [16]", "Elovl4 [31,38]", "Ptpn21 [31,32]", "Tulp1 [31,33,35,38,40]"], ["Cd276", "Mef2d [31,33]", "Snrk [31]", "Eml3", "Rab28 [16,31]", "Uckl1 [32]"], ["Cdh13 [16],", "Mlf1", "Ssx2ip [31]", "Eml5", "Rbp3 [31,34-36,38-41]"], ["Cdk2ap2", "Mmd", "Strbp", "Eno2 [16,31]", "Rcvrn [16,31,36,37]"], ["Cltb//LOC100046457", "Mtap7", "Sugp2", "Flcn", "Rd3 Sie [32]", "Unc119 [31,32,36,38,40]"], ["Cngb1 [35,36],", "Mtch2", "Supt16h", "Frmd4b [31]", "Rdh12 [32,34,35,38,40]"], ["Cngb3 [16,32,36,38,40,42],", "Mtfr1 [16]", "Suv39h2", "Gnat1 [31,32,36-38,40]", "Rho [16,30-32,34-38,40,42]"], ["Cnnm2", "Mylk [31]", "Syp [31,36,38]", "Gnb3 [31,32,36]", "Rhpn1", "Vldlr [31]"], ["Cpt1a", "Myo6", "Tdrd7 [31]", "Gngt1 [16,31,34-36]", "Rom1 [31,35-38,40]"], ["Crnkl1", "Naaa", "Tle2", "Gulo [36,40]", "Rp1", "Vopp1"], ["Cst3 [31]", "Nap1l1", "Tmem135", "Hcn1 [38]", "Rpgr [32]", "Zranb1"], ["Ctbp2 [31]", "Napg", "Tmem216", "Icmt [31]", "Rpgrip1 [31, 32, 34, 38-40]"], ["Dctn1 [31]", "Nfic [37]", "Tmem30a [31]", "Impdh1 [32,38]", "Rraga", ""], ["Dhrs3", "Npnt", "Tmem42", "Kcnb1 [31,37]", "Rs1 [31,32,34,35,38,40]"], ["Dlg4 [16,37]", "Nt5e [16,34]", "Tmem9 [31]", "Klc3 [31]", "Rtbdn", ""], ["Dnm1", "Nxnl1 [40]", "Tpp1", "Krt18", "Rxrg [30]", ""], ["Dnmt3a [31]", "Oat [38,40]", "Trim3", "Llgl2 [34]", "Sag [31,34-36,38,40]"], ["Ebpl", "Osgep [40]", "Uqcr11", "Lpgat1 [31,37]", "", ""], ["Epb4.1l2 [31]", "Paqr4", "Vamp2", "Lrrc48", "", ""]], "row_count": 42, "column_count": 6, "numeric_cells": 148, "header_rows": 1, "locator": "section[17]/table-wrap[1]#t2"}}, {"id": "asset:table:pmid:25678762:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:00d7c59b9ba3f333b473cf34e19834ea737e132226e9578ece17e6ba9d40aeea", "bytes": 2732, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[2]#t3", "version": null, "note": "Genes downregulated in rods, as determined by downregulation in FACSed Rho-eGFP positive cells and expression changes in at least 2/3 other comparisons (RPC versus pn1, RPC versus pn5, pn1 versus pn5).", "structure": {"pmcid": "PMC4301594", "section_index": 17, "section_title": "Results", "row_count": 49, "column_count": 5}, "table": {"label": "Table 3", "caption": "Genes downregulated in rods, as determined by downregulation in FACSed Rho-eGFP positive cells and expression changes in at least 2/3 other comparisons (RPC versus pn1, RPC versus pn5, pn1 versus pn5).", "rows": [["Downregulated genes.", "", "", ""], ["1110002B05Rik", "Dbn1", "Itgb1", "Pip4k2a", "Spred1"], ["1190002N15Rik", "Dkk3 [31]", "Itm2c", "Pkia [31]", "Srgap3"], ["2700094K13Rik", "Dpysl4", "Kcnmb4", "Plagl1 [37]", "Sri [32]"], ["41160", "Dpysl5", "Kctd17", "Ppap2b", "St14"], ["6330527O06Rik [31]", "Ebf1", "Kdr", "Ppic", "St6galnac5"], ["Abcd2 [39]", "Epdr1", "Khdrbs3", "Ppp1r14b [31]", "St8sia2"], ["Adam12", "Epha3", "Klhl13", "Pros1", "Stmn2"], ["Agap1", "Evl", "Laptm4a", "Ptgds", "Stmn4"], ["Aif1l", "F2r", "Ldb1 [32]", "Ptn", "Sulf2"], ["Aldh2", "Fads1", "Lgr5", "Ptprk", "Tcf7l1"], ["Ank3 [32]", "Fam19a5", "Limk1", "Ptprz1", "Tcf7l2"], ["Ankrd43", "Fbxw7", "Litaf [31]", "Qk", "Tcfap2a"], ["Anxa5", "Fezf2", "Lrp1", "Rab31", "Tcfap2b"], ["Arhgdia", "Fgf13", "Lrrn1", "Rai14", "Tcfap2c"], ["Arrb1", "Fgf15", "Magt1", "Rap2b", "Tiam1"], ["Ass1", "Fgf9", "Map4k4 [31]", "Rftn2", "Timp2 [31]"], ["Astn1", "Fgfr1", "Mapk6 [31]", "Rgl1", "Tmeff2"], ["Atp2b2", "Fgfrl1 LOC100046239", "Marveld1", "Rgs2", "Tmem43"], ["Auts2 [32]", "Fjx1", "Mdk", "Rnasel [31]", "Tmtc4"], ["B2m", "Fkbp7", "Mfge8", "Rnd3", "Tnfrsf21"], ["Basp1 LOC100045716", "Fkbp9", "Mllt11", "Rrh", "Tor1aip2"], ["Bcl11a", "Foxn4", "Mmp2", "Rrm2", "Tpbg"], ["Bhlhe22", "Ftl1/2/Gm10116", "Mpp3", "Rsu1", "Traf4"], ["Cadps [31]", "Fuca1", "Msn", "Rtn4 [31]", "Tspan14"], ["Capn2", "Fyn", "Mt1", "Sash1", "Vim"], ["Cartpt", "Gad2", "Mtap6", "Sat1 [31]", "Ywhag [37]"], ["Cat", "Gm3932", "Myadm", "Scd2 [37]", "Zbtb12"], ["Cbx2", "Gng3", "Myb [30,37]", "Sema4d", ""], ["Ccng2 [31]", "Gp1bb", "Ncan", "Sepp1", "Downregulated"], ["Cd151 [39]", "Gpc1 [31]", "Ndrg4", "Serpine2", "+ Neighbours"], ["Cd9", "Gpc3", "Neurod4 [30,33,37]", "Serping1", "Cmtm7"], ["Cdc42se1", "Gpr37 [31]", "Nfia", "Serpinh1", "Darc"], ["Cfl1 [30]", "Gpr56", "Nfib [35]", "Serpini1", "Ebf3"], ["Chn2", "Gprc5c", "Nfix [31,35]", "Sfxn1", "Efnb2 [37]"], ["Chodl", "Grb10", "Ngfr", "Sgk3", "Elavl3"], ["Cnot2 [35]", "Grn", "Nhsl1", "Sh3bp4", "Hmx1"], ["Cntnap2 [32]", "Gstm1", "Nme2", "Six3", "Kcnk1"], ["Col18a1", "H19 [35]", "Notch2", "Skap2", "Kif5c [32]"], ["Col2a1 [38,40]", "H2afy2", "Npc2", "Slc1a3", "Klc1, LOC100047609"], ["Crabp1", "Hbb-b1/Hbb-b2", "Olfm1 [32]", "Slc1a4", "Meg3"], ["Crmp1", "Hkdc1", "Olig2", "Slc32a1", "Pmepa1"], ["Crym [41]", "Hmgb2 [37]", "Pak1", "Smad2", "Rian"], ["Csnk1e", "Ier5", "Pax6 [30,31]", "Smarce1", "Stmn1"], ["Csrp1 [37]", "Igfbp2", "Pbxip1", "Socs2", "Tbx2"], ["Ctsc", "Il17ra", "Pcp4", "Sox5", "Vsx2"], ["Cyp26a1", "Ina", "Pcyox1", "Sox6", "Zfp532"], ["Dag1", "Isl1 [31,37]", "Pdlim5", "Sparc [31]", ""], ["Dbi", "Itgav", "Phlpp1", "Spc25", ""]], "row_count": 49, "column_count": 5, "numeric_cells": 77, "header_rows": 1, "locator": "section[17]/table-wrap[2]#t3"}}, {"id": "asset:table:pmid:25678762:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2be9781585e10bfd5457f8e3020c94f717bb18d545ea8dc76f3012c1aa40b667", "bytes": 1761, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[3]#t4", "version": null, "note": "Genes differentially regulated in all comparisons of RPC versus pn1, RPC versus pn5, pn1 versus pn5 (but not significantly changed between FACS positive and negative samples).", "structure": {"pmcid": "PMC4301594", "section_index": 17, "section_title": "Results", "row_count": 37, "column_count": 3}, "table": {"label": "Table 4", "caption": "Genes differentially regulated in all comparisons of RPC versus pn1, RPC versus pn5, pn1 versus pn5 (but not significantly changed between FACS positive and negative samples).", "rows": [["Differentially regulated genes", "", ""], ["ENSMUSG00000063277", "Grina", "Rbpms"], ["1200009O22Rik", "H3f3b [31]", "Rffl"], ["1700020C11Rik [31]", "Hba-a1, Hba-a2 [31]", "Rnmt"], ["1810009A15Rik", "Hist2h2aa1, Hist2h2aa2, Hist2h2ac, Hist2h3c1", "Rpl19"], ["2310028O11Rik", "Hmgn1", "Sdha"], ["2310044H10Rik", "Hsd17b4", "Sfrs14 [31]"], ["2410017P09Rik", "Hspe1", "Snrnp40"], ["Acadl", "Jam2 [31]", "Snrpn /// Snurf [37]"], ["Ak3l1 /// LOC100047616", "Lhx9", "Sox6"], ["Asf1a", "LOC100044115, Rin2", "Sub1"], ["Atp5k", "LOC100044139, Snrpn, Snurf", "Tspan31"], ["Banf1", "LOC100045551, Ppm1d", "Tspan7"], ["BC016201 [31]", "LOC100046232, Nfil3", "Tuba1a"], ["Cadm3", "LOC100046704, Nras", "Txn1"], ["Calb1", "LOC100047393, Nae1", "Uba2"], ["Chrna6", "LOC677317, Me1", "Ube2d2"], ["Cox6b1", "Mcm7 [30]", "Ube2e1"], ["Cox7c, LOC100047065, LOC100048613", "Mdfic", "Vsnl1 [31]"], ["Cplx3", "Med19", ""], ["D0H4S114", "Ndrg1 [37]", "Diff regulated + Neighbours"], ["Dab2ip", "Ndrg4", "Otx2 [30,34]"], ["Deb1", "Ndufa6 [31]", "Stxbp1 [31]"], ["Dohh", "Nlk [31]", ""], ["Eef1b2", "Notch4", ""], ["Eef1g, LOC100047986", "P4hb", ""], ["Extl3", "Pcdhga1-12, Pcdhgb1-8, Pcdhgc3-5 [31]", ""], ["Fam108a", "Phactr1 [31]", ""], ["Fam125a", "Phb", ""], ["Fkbp3", "Pip5k1a", ""], ["Gba2", "Pkig [31]", ""], ["Gdpd5", "Pnkd", ""], ["Glo1 [31]", "Polr2e", ""], ["Hist1h2bc, Hist1h2be, Hist1h2bl, Hist1h2bm, Hist1h2bp, LOC100046213", "Prdx3", ""], ["Gm5256, Gm5529, Slc25a5", "Prkar1b [31]", ""], ["Gm6293, Uqcr10", "Prnp [31]", ""], ["Gm9800, Ptma", "Psrc1", ""]], "row_count": 37, "column_count": 3, "numeric_cells": 48, "header_rows": 1, "locator": "section[17]/table-wrap[3]#t4"}}, {"id": "asset:table:pmid:25678762:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:50e943e37c54f246de959a63e835068c2199d15fdfbf648637e62418ffe33224", "bytes": 2981, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[4]#t5", "version": null, "note": "Expression “neighbours” of well-known retinal and eye specification genes, as determined by t-SNE.", "structure": {"pmcid": "PMC4301594", "section_index": 17, "section_title": "Results", "row_count": 35, "column_count": 6}, "table": {"label": "Table 5", "caption": "Expression “neighbours” of well-known retinal and eye specification genes, as determined by t-SNE.", "rows": [["Expression pattern neighbours of selected retinopathy genes", "", ""], ["1110051M20Rik", "Crx [32,33,35,38,40]", "Gnat1 [31,36-38,40]", "Mpp7", "Pstk", "Smarcd2 [31]"], ["A530058N18Rik", "Crxos1 [39]", "Gnb1 [36,38,40]", "Mrpl49 [31]", "Ptp4a3 [16,31,32]", "Smpd2"], ["Abcg4 [32]", "D0Kist5", "Gnb3 [31,36]", "Mtfp1", "Ptpn21 [31,32]", "Snap25 [16,31,36,38]"], ["Acsl1", "D2Ertd63e", "Gngt1 [16,31,34-36]", "Mthfr", "Rab27a", "Snta1 [16,31]"], ["Adcy7", "Dalrd3", "Grk1 [32,34,38]", "Ndrg1 [37]", "Rab28 [16,31]", "Spint2"], ["Agtpbp1 [31,32]", "Darc", "Gucy2e [42]", "Ndufv1", "Rbks", "St3gal3 [32]"], ["Aipl1 [31,32,35-38]", "Dgke", "Guk1", "Neurog2 [30]", "Rbp3 [31,35,36,38-41]", "St6galnac2"], ["Amy1", "Dleu2", "Gulo [36,40]", "Nme5", "Rcvrn [16,30,31,36,37]", "Stk39 [31]"], ["Ankrd33 [31,37]", "Dnaja4", "Hcn1 [38]", "Nr2e3 [31,34-36,38,40]", "Rd3 40", "Stmn1"], ["Ap1b1 [31]", "Doc2b [31]", "Heph", "Nr6a1", "Rdh12 [32,34,35,38,40]", "Stx3 [31,42]"], ["Ap2m1 [31]", "Dusp26", "Hmx1", "Nrl [31,34-36,38,40]", "Rho [16,30-32,34-38,40,42]", "Stxbp1 [31]"], ["Arl6 [38],", "Ebf3", "Icmt [31]", "Nsf", "Rhpn1", "Suv39h2"], ["B9d1", "Efnb2 [31]", "Ift81", "Nxnl2 [35]", "Rian", "Syngr1"], ["Bbs9 [16,35,38],", "Elavl3", "Igsf9", "Otud7b", "Rnf157", "Sys1"], ["BC027072 [35],", "Elovl2", "Impdh1 [38]", "Otx2 [33,38]", "Rom1 [30,31,35,36,38,40]", "Syt1 [16,32]"], ["Btc [16,31,42]", "Elovl4 [31,38]", "Impg1 [35]", "Pax6 [30,31]", "Rp1", "Tbc1d8 [34]"], ["C1ql3", "Eml3 [31]", "Itfg2 [31]", "Pdc [30,34,36,38]", "Rpgr [32]", "Tbx2"], ["Calml4", "Eml5", "Kcnb1 [31,37]", "Pde6a [30,32,35,36,38,40]", "Rpgrip1 [31,34,35,38-40]", "Tmeff1"], ["Camk2d [31]", "Endod1", "Kcnk1", "Pde6b [16,30-32,35-38,40]", "Rraga", "Tmem229b"], ["Camsap1 [31,32]", "Eno2 [16,31]", "Kif5c", "Pde6g [16,30-32,34-36,38,40]", "Rs1 [31,34,35,37,38,40]", "Tob2"], ["Cdhr1 [34]", "Eno3", "Kif9", "Pex11a", "Rsph9", "Tox"], ["Cdk5r2", "Epb4.1l3 [31]", "Klc1", "Pex5l", "Rtbdn", "Ttc8 [16,38,40]"], ["Cep250", "Ezh1", "Klc3 [31]", "Pitpnm1 [31]", "Rxrg [36]", "Tub [31]"], ["Cep290 [32,38]", "Fabp4", "Krt18", "Pja1", "Sag [31,34,36,38,40]", "Tuba4a"], ["Chchd10", "Fam132a", "Llgl2 [34]", "Pmepa1", "Samd11 [31,35]", "Tulp1 [31,33,35,38,40]"], ["Chga [31]", "Fam161a", "Lpgat1 [31,37]", "Podxl [16,31,34,42]", "Sec14l2 [34]", "Uckl1"], ["Chrna5 [16,42]", "Fam89a", "Lrp2", "Ppef2", "Sema7a [16]", "Unc119 [31,36,38,40]"], ["Ckmt1", "Fance", "Lrrc48", "Ppm1b [31]", "Sez6 [16,42]", "Unc13b"], ["Clstn1 [16,31,42]", "Fbrs", "Lztfl1", "Ppp3cc", "Shisa2 [42]", "Vldlr [31]"], ["Cmtm7", "Flcn", "Magi2 16", "Prdm9", "Slc12a5", "Vopp1"], ["Cnga1 [16,34,36-38,40,42]", "Foxo1 [31]", "Mak [31,34,35]", "Prickle1 [31]", "Slc19a1", "Vsx2"], ["Cplx3", "Frmd4b [31]", "Mdm1", "Prkab1 [31]", "Slc25a33", "Vtn [31,32]"], ["Cplx4 [16,34],", "Fyco1", "Meg3", "Prom1 [16,31,34,38,40,42]", "Slc27a2", "Zfp532"], ["Crmp1", "Gdpd3", "Mpp4 [35]", "Prr14", "Slc7a8 [16]", "Zranb1"]], "row_count": 35, "column_count": 6, "numeric_cells": 125, "header_rows": 1, "locator": "section[17]/table-wrap[4]#t5"}}, {"id": "asset:table:pmid:25678762:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0f4e709379c93cdf320c37555bd0a0ae7c6f546c8e73356efb1212374875fc14", "bytes": 4148, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[1]#t6", "version": null, "note": "Functions of selected genes also identified in other retinal array studies.", "structure": {"pmcid": "PMC4301594", "section_index": 23, "section_title": "Discussion", "row_count": 7, "column_count": 4}, "table": {"label": "Table 6", "caption": "Functions of selected genes also identified in other retinal array studies.", "rows": [["Gene Title and symbol", "Functions", "Retinal functions", "References"], ["betacellulin, epidermal growth factor family member Btc", "Member of the EGF family of growth factors, synthesized primarily as a transmembrane precursor, which is then processed to mature molecule by proteolytic events. This protein is a ligand for the EGF receptor. Involved in propagating luteinizing hormone signalling through the ovary during ovulation. Constituent of bone marrow stem cell conditioned medium (BMSC medium),", "BMSC medium treated RPCs are more likely to favour neural differentiation.May also enhance RPC proliferation. Overexpressed in diabetic mice, may contribute to increased vascular permeability and vascular oedema, leading to diabetic retinopathy.", "Gene ID:685. OMIM 600345 [63,64]."], ["synaptosomal-associated protein 25 Snap25", "Snap25 is a presynaptic plasma membrane protein involved in the regulation of neurotransmitter release. Neuronal exocytosis requires 3 SNARE proteins: synaptobrevin on the synaptic vesicle, and syntaxin and SNAP25 on the plasma membrane. Expressed in ribbon synapses from pn4, may be involved in their organization.", "Strongly expressed in horizontal cells. Thought to play role in photoreceptor development. Expressed in the Golgi complex of retinal neurons as well as involvement in synaptic vesicle release. It is located in the perinuclear compartment of retinal neurons", "Gene ID: 6616, OMIM 600322 [65-67],"], ["complexin 4 Cplx4", "Probable member of the complexin family, may be involved in synaptic vesicle exocytosis. Contains a C-terminal CAAX box motif for posttranslational prenylation. Expression is retinal specific, or restricted to eye and retina (databases). Expression seems to be localized to rod photoreceptor ribbon synapses. Positive regulator of synaptic transmission in mouse hippocampal neurons.", "Present in IPL and bipolar cell synapses. Double Cplx3/4 KO mice show behavioural responses suggestive of visual deficit and disordered ribbon synapses. Ganglion cell ON and OFF synapses also affected differentially. Essential regulators of neurotransmission at retinal ribbon synapses.", "Gene ID:339302 OMIM609586 [68,69]."], ["podocalyxin-like Podxl", "Member of the sialomucin protein family. Important component of glomerular podocytes. Other biological activities include binding in a membrane protein complex with Na+/H+ exchanger regulatory factor to intracellular cytoskeletal elements, playing a role in hematopoetic cell differentiation, and being expressed in vascular endothelium cells and L-selectin binding. Highest expression in kidney, pancreas and heart. Linked to ezrin and the actin cytoskeleton via Nherf2.", "Identified via array as a marker of early rod precursors which are capable of integrating into recipient retinas after transplantation.", "[31] Gene ID: 5420. OMIM602632."], ["calsyntenin 1 Clstn1", "Isolated from brain cDNA library, expressed by >90% of neurons. Localized in post-synaptic membrane. Signalling may be by proteolytic cleavage. Expression raised in Alzheimers and Parkinsons samples decreased in neuroblastoma. Localized in organelles alongside microtubules, partially co-localized with kinesin. Organelles transported in a manner consistent with fast axonal transport.", "Unknown", "Gene ID: 22883 OMIM611321 [70,71]"], ["cholinergic receptor, nicotinic, alpha polypeptide 5 Chrna5", "Nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2), variants are associated with increased risk of nicotine addiction, a propensity shared with Chrna5 knockout mice. Evolution of this gene in primates has been faster than would be expected by chance, may be involved in the evolution of larger brains in humans.", "Unknown", "Gene ID: 1138. OMIM118505 [72,73]."]], "row_count": 7, "column_count": 4, "numeric_cells": 14, "header_rows": 1, "locator": "section[23]/table-wrap[1]#t6"}}, {"id": "asset:table:pmid:25678762:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:05c0a8ad30f87930bcb62482d5f9e9cccb501066f01ae3fbe2043c0a7caef53f", "bytes": 4053, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[2]#t7", "version": null, "note": "Functions of selected genes confirmed by qPCR (see Figure 2 and Supplementary Datafile 4 for associated qPCR results).", "structure": {"pmcid": "PMC4301594", "section_index": 23, "section_title": "Discussion", "row_count": 9, "column_count": 4}, "table": {"label": "Table 7", "caption": "Functions of selected genes confirmed by qPCR (see Figure 2 and Supplementary Datafile 4 for associated qPCR results).", "rows": [["Gene Title and Symbol", "Functions", "Retinal functions", "References"], ["low density lipoprotein receptor-related protein 4 Lrp4", "Member of the low-density lipoprotein receptor-related protein family, may be a Wnt signaling regulator. Contains EGF like domain. Co-ordinates synapse formation at neuromuscular junctions. Mutated in Cenani-Lenz syndactyly syndrome and sclerosteosis. Knockout mice are growth retarded with fully penetrant polysyndactyly in their fore and hind limbs and partially penetrant abnormalities of tooth development.", "unknown", "Gene ID: 4038, OMIM604270"], ["A530058N18Rik RIKEN cDNA , A530058N18Rik", "No human homologue noted. Uncharacterised", "unknown", "Gene ID: 320846."], ["sterile alpha motif domain containing 11, SamD11", "Relatively uncharacterised. May promote cell proliferation slightly. Evolutionarily conserved from zebrafish to human. High expression levels in mouse retina, but human SamD11 is more widely expressed.", "Mouse SamD11 is expressed in developing photoreceptors and the pineal gland; expression is controlled by Crx.", "Gene ID: 148398 [74]."], ["Cdk2ap2 CDK2-associated protein 2, Cdk2ap2", "Interacts with cyclin-dependent kinase 2 associated protein 1. May be involved in self renewal regulation in ES cells; knockout ESCs showed an early differentiation phenotype, but embryoid bodies were unhealthy and showed high levels of apoptosis. Knockout ESCs were unable to form teratomas in SCID mice.", "unknown", "Gene ID: 10263 [75]."], ["peroxisome proliferative activated receptor, gamma, coactivator 1 alpha, Ppargc1a", "Transcriptional coactivator regulating genes involved in energy metabolism. Interacts with PPARgamma, permitting interaction with multiple transcription factors. It provides a direct link between external physiological stimuli and the regulation of mitochondrial biogenesis (particularly vital in the retina), and is a major factor regulating muscle fiber type determination. May also be involved in controlling blood pressure, regulating cellular cholesterol homoeostasis, and the development of obesity. Ppargc1a/Ppargc1b double knockouts show heart abnormalities.", "SNP associated with neovascularization in AMD. Regulates VEGF in the retina, is strongly upregulated during postnatal retinal development, and is necessary for normal retinal vascularization. Knockout mice have reduced retinal vasculature. Regulator of interneuron function, master regulator of metabolism in peripheral tissues.", "[76-78] Gene ID:10891"], ["cDNA sequence BC027072, BC027072", "68% identity to human C2ORF71, which causes RP when mutated. Homology possibly not high enough to say this is definitively the mouse homologue. C2ORF71 causes digenic Usher syndrome when mutations in CEP250 are also present", "C2ORF71 is predominantly retinally expressed and localizes to the primary cilium of photoreceptor cells. Function otherwise uncharacterised.", "OMIM613425 [79-81]."], ["nuclear receptor subfamily 6, group A, member 1, Nr6a1", "Orphan nuclear receptor, member of the nuclear hormone receptor family. Homodimerizes and binds DNA, but in vivo targets unidentified. High level expression in testis, promotes neural development in early embryogenesis via suppression of Oct4", "unknown", "Gene ID: 2649 [82,83]."], ["kinesin family member 9 /// similar to kinesin family member 9, Kif9", "Expression downregulated during hippocampal development and upregulated during kidney development. Interacts with GEM and stabilised microtubules. Gem and Kif9 are responsible for the regulation of spindle length during mitosis. Spindle abnormalities are seen when either protein is downregulated.", "Co-ordinated expression with Atoh1 during hair cell development in the inner ear; candidate gene for Usher syndrome?", "OMIM607910. Gene ID: 64147 [84,85]"]], "row_count": 9, "column_count": 4, "numeric_cells": 21, "header_rows": 1, "locator": "section[23]/table-wrap[2]#t7"}}], "gaps": ["asset:data:geo:GSE59201 not downloaded", "asset:data:geo:GSE59201 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Expression across different conditions, together with associated significance tests, were performed using R and Limma [48,49]."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE59201"], "resolved_accessions": ["GSE59201"], "statements": ["All data have been submitted to GEO ([55]) in accordance with MIAMI standards [56,57]. The GEO accession number for this data set is GSE59201."], "basis": "The paper names GSE59201 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:25678762", "data:geo:GSE59201", "asset:table:pmid:25678762:1", "asset:table:pmid:25678762:2", "asset:table:pmid:25678762:3", "asset:table:pmid:25678762:4", "asset:table:pmid:25678762:5", "asset:table:pmid:25678762:6", "asset:table:pmid:25678762:7"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE59201"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": null, "independence": "same_provider"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 0, "usage": {}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:25678762", "type": "paper", "label": "pmid:25678762"}, {"id": "source:pmid:25678762", "type": "manuscript", "label": "PMID 25678762 full text"}, {"id": "data:geo:GSE59201", "type": "dataset", "label": "GEO GSE59201"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:25678762", "type": "paper", "label": "pmid:25678762"}, {"id": "source:pmid:25678762", "type": "manuscript", "label": "PMID 25678762 full text"}, {"id": "data:geo:GSE59201", "type": "dataset", "label": "GEO GSE59201"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-25678762", "type": "extraction", "used": ["source:pmid:25678762"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE59201", "type": "accession_resolution", "used": ["data:geo:GSE59201"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:25678762", "parent_hash": "sha256:f8c9835982440772ec4bc659e247c499fbf2296434e47db558c40687ecf28594", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE59201 licence not read", "asset:data:geo:GSE59201 not downloaded", "doi", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.69, "evidence": ["f the retina. Rod progenitors from postnatal mouse retinas can be transplanted and can form pho"], "order_basis": "paper_text_order:675", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ssion differences between postnatal retinas, cultured retinal progenitor cells (RPCs), and rod pho", "e medium after 7 days of culture. Cells were passaged when 80–90% confluent. About 0.5 ml 0.25% tr"], "order_basis": "paper_text_order:1019", "id": "assay:2"}, {"role": "data_generation", "definition_id": "flow_cytometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["onally, fluorescence-activated cell sorting (FACS) sorted Rho-eGFP-expressing rod photorecepto", "transplantable photoreceptors. Additionally, fluorescence-activated cell sorting (FACS) sorted Rho-eGFP-expressing rod photor", "eptors. Additionally, fluorescence-activated cell sorting (FACS) sorted Rho-eGFP-expressing rod photor"], "order_basis": "paper_text_order:1455", "id": "assay:3"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["n reaction (q-PCR). RESULTS: Analysis of the microarray data sets, including the use of t-distribute"], "order_basis": "paper_text_order:1739", "id": "assay:4"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Expression across different conditions, together with associated significance tests, were performed using R and Limma [48,49]."], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}