PPIC, EMP3 and CHI3L1 Are Novel Prognostic Markers for High Grade Glioma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:27801851", "kind": "science-record", "revision": 8, "content_hash": "sha256:9c19ea33c4bcf2a0bad2e9eb79d5393ac9cc9268d56e4b217285f9fb6d78bf77", "created_at": "2026-11-01T15:40:21Z", "updated_at": "2026-11-01T21:59:12Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "PPIC, EMP3 and CHI3L1 Are Novel Prognostic Markers for High Grade Glioma.", "doi": "10.3390/ijms17111808", "pmid": "27801851", "authors": ["Yuan-Feng Gao", "Tao Zhu", "Chen-Xue Mao", "Zhi-Xiong Liu", "Zhi-Bin Wang", "Xiao-Yuan Mao", "Ling Li", "Ji-Ye Yin", "Hong-Hao Zhou", "Zhao-Qian Liu"], "journal": "International journal of molecular sciences", "year": 2016, "abstract": "Current treatment methods for patients diagnosed with gliomas have shown limited success. This is partly due to the lack of prognostic genes available to accurately predict disease outcomes. The aim of this study was to investigate novel prognostic genes based on the molecular profile of tumor samples and their correlation with clinical parameters. In the current study, microarray data (GSE4412 and GSE7696) downloaded from Gene Expression Omnibus were used to identify differentially expressed prognostic genes (DEPGs) by significant analysis of microarray (SAM) between long-term survivors (>2 years) and short-term survivors (≤2 years). DEPGs generated from these two datasets were intersected to obtain a list of common DEPGs. The expression of a subset of common DEPGs was then independently validated by real-time reverse transcription quantitative PCR (qPCR). Survival value of the common DEPGs was validated using known survival data from the GSE4412 and TCGA dataset. After intersecting DEPGs generated from the above two datasets, three genes were identified which may potentially be used to determine glioma patient prognosis. Independent validation with glioma patients tissue (n = 70) and normal brain tissue (n = 19) found PPIC, EMP3 and CHI3L1 were up-regulated in glioma tissue. Survival value validation showed that the three genes correlated with patient survival by Kaplan-Meir analysis, including grades, age and therapy.", "claims": [{"id": "claim-data-access", "statement": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:27801851", "locator": "sections[10] \"4.1. Affymetrix Microarray Data\" paragraph 2", "quote": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database."}, {"asset": "source:pmid:27801851", "locator": "sections[10] \"4.1. Affymetrix Microarray Data\" paragraph 2", "quote": "The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array."}, {"asset": "source:pmid:27801851", "locator": "sections[10] \"4.1. Affymetrix Microarray Data\" paragraph 2", "quote": "Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412."}], "state": "complete"}, {"id": "claim-target-result", "statement": "The study identified PPIC, EMP3, and CHI3L1 as three common differentially expressed prognostic genes in glioma.", "kind": "quantitative", "target": {"value": 0.05, "unit": "p-value", "tolerance": null, "source": "Genes were considered differentially expressed when meeting the cut-off criterion of |log fold change (FC)| ≥ 1.5 and p < 0.05."}, "evidence": [{"asset": "source:pmid:27801851", "locator": "sections[3] \"2.1. Identification of DEPGs\" paragraph 2", "quote": "Intersection of the DEPGs revealed a total of three common DEPGs—PPIC, EMP3 and CHI3L1—suggesting that these common DEPGs may be potential prognostic indicators of glioma progression (Figure 1E)."}, {"asset": "source:pmid:27801851", "locator": "sections[0] \"Abstract\" paragraph 1", "quote": "In the current study, microarray data (GSE4412 and GSE7696) downloaded from Gene Expression Omnibus were used to identify differentially expressed prognostic genes (DEPGs) by significant analysis of microarray (SAM) between long-term survivors (>2 years) and short-term survivors (≤2 years)."}, {"asset": "source:pmid:27801851", "locator": "sections[11] \"4.2. Differentially Expressed Prognostic Genes (DEPGs) Analysis\" paragraph 2", "quote": "Genes were considered differentially expressed when meeting the cut-off criterion of |log fold change (FC)| ≥ 1.5 and p < 0.05."}, {"asset": "source:pmid:27801851", "locator": "sections[11] \"4.2. Differentially Expressed Prognostic Genes (DEPGs) Analysis\" paragraph 2", "quote": "The results generated from GSE4412 and GSE7696 datasets were then intersected to find DEPGs."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": "The study identified PPIC, EMP3, and CHI3L1 as three common differentially expressed prognostic genes in glioma.", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:27801851"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE4290"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE4290"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:27801851", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3390/ijms17111808", "sha256": "sha256:33be9a55f94dbcde0315188ed3fb07a98575195d456b8d4a97a78ccefcfe9a9e", "bytes": 33682, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3390/ijms17111808", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC5133809", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE4290", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE4290", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE4290", "version": null, "note": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM97793", "GSM97794", "GSM97795", "GSM97796", "GSM97797", "GSM97798", "GSM97799", "GSM97800", "GSM97801", "GSM97802", "GSM97803", "GSM97804", "GSM97805", "GSM97806", "GSM97807", "GSM97808", "GSM97809", "GSM97810", "GSM97811", "GSM97812", "GSM97813", "GSM97814", "GSM97815", "GSM97816", "GSM97817", "GSM97818", "GSM97819", "GSM97820", "GSM97821", "GSM97822", "GSM97823", "GSM97824", "GSM97825", "GSM97826", "GSM97827", "GSM97828", "GSM97829", "GSM97830", "GSM97831", "GSM97832", "GSM97833", "GSM97834", "GSM97835", "GSM97836", "GSM97837", "GSM97838", "GSM97839", "GSM97840", "GSM97841", "GSM97842", "GSM97843", "GSM97844", "GSM97845", "GSM97846", "GSM97847", "GSM97848", "GSM97849", "GSM97850", "GSM97851", "GSM97852", "GSM97853", "GSM97854", "GSM97855", "GSM97856", "GSM97857", "GSM97858", "GSM97859", "GSM97860", "GSM97861", "GSM97862", "GSM97863", "GSM97864", "GSM97865", "GSM97866", "GSM97867", "GSM97868", "GSM97869", "GSM97870", "GSM97871", "GSM97872", "GSM97873", "GSM97874", "GSM97875", "GSM97876", "GSM97877", "GSM97878", "GSM97879", "GSM97880", "GSM97881", "GSM97882", "GSM97883", "GSM97884", "GSM97885", "GSM97886", "GSM97887", "GSM97888", "GSM97889", "GSM97890", "GSM97891", "GSM97892", "GSM97893", "GSM97894", "GSM97895", "GSM97896", "GSM97897", "GSM97898", "GSM97899", "GSM97900", "GSM97901", "GSM97902", "GSM97903", "GSM97904", "GSM97905", "GSM97906", "GSM97907", "GSM97908", "GSM97909", "GSM97910", "GSM97911", "GSM97912", "GSM97913", "GSM97914", "GSM97915", "GSM97916", "GSM97917", "GSM97918", "GSM97919", "GSM97920", "GSM97921", "GSM97922", "GSM97923", "GSM97924", "GSM97925", "GSM97926", "GSM97927", "GSM97928", "GSM97929", "GSM97930", "GSM97931", "GSM97932", "GSM97933", "GSM97934", "GSM97935", "GSM97936", "GSM97937", "GSM97938", "GSM97939", "GSM97940", "GSM97941", "GSM97942", "GSM97943", "GSM97944", "GSM97945", "GSM97946", "GSM97947", "GSM97948", "GSM97949", "GSM97950", "GSM97951", "GSM97952", "GSM97953", "GSM97954", "GSM97955", "GSM97956", "GSM97957", "GSM97958", "GSM97959", "GSM97960", "GSM97961", "GSM97962", "GSM97963", "GSM97964", "GSM97965", "GSM97966", "GSM97967", "GSM97968", "GSM97969", "GSM97970", "GSM97971", "GSM97972"], "sample_count": 180, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression data of glioma samples from Henry Ford Hospital", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE4412", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE4412", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE4412", "version": null, "note": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM99432", "GSM99433", "GSM99434", "GSM99435", "GSM99436", "GSM99437", "GSM99438", "GSM99439", "GSM99440", "GSM99441", "GSM99442", "GSM99443", "GSM99444", "GSM99445", "GSM99446", "GSM99447", "GSM99448", "GSM99449", "GSM99450", "GSM99451", "GSM99452", "GSM99453", "GSM99454", "GSM99455", "GSM99456", "GSM99457", "GSM99458", "GSM99459", "GSM99460", "GSM99461", "GSM99462", "GSM99463", "GSM99464", "GSM99465", "GSM99466", "GSM99467", "GSM99468", "GSM99469", "GSM99470", "GSM99471", "GSM99472", "GSM99473", "GSM99474", "GSM99475", "GSM99476", "GSM99477", "GSM99478", "GSM99479", "GSM99480", "GSM99481", "GSM99482", "GSM99483", "GSM99484", "GSM99485", "GSM99486", "GSM99487", "GSM99488", "GSM99489", "GSM99490", "GSM99491", "GSM99492", "GSM99493", "GSM99494", "GSM99495", "GSM99496", "GSM99497", "GSM99498", "GSM99499", "GSM99500", "GSM99501", "GSM99502", "GSM99503", "GSM99504", "GSM99505", "GSM99506", "GSM99507", "GSM99508", "GSM99509", "GSM99510", "GSM99511", "GSM99512", "GSM99513", "GSM99514", "GSM99515", "GSM99516", "GSM99517", "GSM99518", "GSM99519", "GSM99520", "GSM99521", "GSM99522", "GSM99523", "GSM99524", "GSM99525", "GSM99526", "GSM99527", "GSM99528", "GSM99529", "GSM99530", "GSM99531", "GSM99532", "GSM99533", "GSM99534", "GSM99535", "GSM99536", "GSM99537", "GSM99538", "GSM99539", "GSM99540", "GSM99541", "GSM99542", "GSM99543", "GSM99544", "GSM99545", "GSM99546", "GSM99547", "GSM99548", "GSM99549", "GSM99550", "GSM99551", "GSM99552", "GSM99553", "GSM99554", "GSM99555", "GSM99556", "GSM99557", "GSM99558", "GSM99559", "GSM99560", "GSM99561", "GSM99562", "GSM99563", "GSM99564", "GSM99565", "GSM99566", "GSM99567", "GSM99568", "GSM99569", "GSM99570", "GSM99571", "GSM99572", "GSM99573", "GSM99574", "GSM99575", "GSM99576", "GSM99577", "GSM99578", "GSM99579", "GSM99580", "GSM99581", "GSM99582", "GSM99583", "GSM99584", "GSM99585", "GSM99586", "GSM99587", "GSM99588", "GSM99589", "GSM99590", "GSM99591", "GSM99592", "GSM99593", "GSM99594", "GSM99595", "GSM99596", "GSM99597", "GSM99598", "GSM99599", "GSM99600", "GSM99601"], "sample_count": 170, "group_sizes": null, "group_sizes_basis": null, "platform": "96;97", "taxon": "Homo sapiens", "title": "freij-affy-human-91666", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE7696", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE7696", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE7696", "version": null, "note": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM187153", "GSM187154", "GSM187155", "GSM187156", "GSM187157", "GSM187158", "GSM187159", "GSM187160", "GSM187161", "GSM187162", "GSM187163", "GSM187164", "GSM187165", "GSM187166", "GSM187167", "GSM187168", "GSM187169", "GSM187170", "GSM187171", "GSM187172", "GSM187173", "GSM187174", "GSM187175", "GSM187176", "GSM187177", "GSM187178", "GSM187179", "GSM187180", "GSM187181", "GSM187182", "GSM187183", "GSM187184", "GSM187185", "GSM187186", "GSM187187", "GSM187188", "GSM187189", "GSM187190", "GSM187191", "GSM187192", "GSM187193", "GSM187194", "GSM187195", "GSM187196", "GSM187197", "GSM187198", "GSM187199", "GSM187200", "GSM187201", "GSM187202", "GSM187203", "GSM187204", "GSM187205", "GSM187206", "GSM187207", "GSM187208", "GSM187209", "GSM187210", "GSM187211", "GSM187212", "GSM187213", "GSM187214", "GSM187215", "GSM187216", "GSM187217", "GSM187218", "GSM187219", "GSM187220", "GSM187221", "GSM187222", "GSM187223", "GSM187224", "GSM187225", "GSM187226", "GSM187227", "GSM187228", "GSM187229", "GSM187230", "GSM187231", "GSM187232", "GSM187233", "GSM187234", "GSM187235", "GSM187236"], "sample_count": 84, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Glioblastoma from a homogenous cohort of patients treated within clinical trial", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:27801851:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f5ea95aec2e6114b27b3abe489ef41bb6e3d752d3271b6237528bf0e18504cb2", "bytes": 1157, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[1]#ijms-17-01808-t001", "version": null, "note": "Correlation between PPIC/EMP3/CHI3L1 expression and glioma clinicopathologic features in 70 patients.", "structure": {"pmcid": "PMC5133809", "section_index": 4, "section_title": "2.2. Independent Validation of Glioma-Specific Markers", "row_count": 12, "column_count": 14}, "table": {"label": "Table 1", "caption": "Correlation between PPIC/EMP3/CHI3L1 expression and glioma clinicopathologic features in 70 patients.", "rows": [["", "N%", "PPIC Expression Levels", "", "", "EMP3 Expression Levels", "", "", "CHI3L1 Expression Levels", "", ""], ["High", "Low", "Ratio", "p", "High", "Low", "Ratio", "p", "High", "Low", "Ratio", "p"], ["Expression", "Expression", "(High/Low)", "", "Expression", "Expression", "(High/Low)", "", "Expression", "Expression", "(High/Low)", ""], ["Sex", ""], ["Male", "48 (68.57)", "13", "35", "0.371", "0.184", "16", "32", "0.5", "0.835", "15", "33", "0.454", "0.441"], ["Female", "22 (31.42)", "10", "12", "0.833", "5", "17", "0.294", "7", "15", "0.467"], ["Age, year", ""], ["<45", "45 (64.28)", "13", "32", "0.406", "0.068", "14", "31", "0.452", "0.762", "13", "32", "0.406", "0.965"], ["≥45", "25 (35.72)", "11", "14", "0.786", "7", "18", "0.389", "9", "16", "0.563"], ["Grade", ""], ["Low (I + II)", "38 (54.28)", "7", "31", "0.226", "0.005", "11", "27", "0.407", "0.876", "13", "25", "0.52", "0.935"], ["High (III + IV)", "32 (45.71)", "16", "16", "0.500", "10", "22", "0.454", "9", "23", "0.391"]], "row_count": 12, "column_count": 14, "numeric_cells": 71, "header_rows": 3, "locator": "section[4]/table-wrap[1]#ijms-17-01808-t001"}}, {"id": "asset:table:pmid:27801851:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:1af73da8df207080153b40bb127fe029310e029cb7ccd2cb31d44153c43cd215", "bytes": 723, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#ijms-17-01808-t002", "version": null, "note": "Clinical and histological characteristics of patients with glioma.", "structure": {"pmcid": "PMC5133809", "section_index": 10, "section_title": "4.1. Affymetrix Microarray Data", "row_count": 16, "column_count": 5}, "table": {"label": "Table 2", "caption": "Clinical and histological characteristics of patients with glioma.", "rows": [["Sequence", "GSE4412", "GSE7696", "GSE4290", "TCGA"], ["Patients (n)", "74", "60", "157", "567"], ["Male", "28", "43", "", "347"], ["Female", "46", "17", "", "220"], ["Age (years)", "46 (18–82)", "48 (33–70)", "", "58 (10–89)"], ["Grade (n)", "", "", "", ""], ["I", "", "", "", ""], ["II", "", "", "45", ""], ["III", "24", "", "31", ""], ["IV", "50", "60", "81", "567"], ["Temozolomide (TMZ) (n)", "", "", "", ""], ["Yes", "", "", "", "166"], ["No", "", "", "", "401"], ["Radiotherapy Z (n)", "", "", "", ""], ["Yes", "", "", "", "422"], ["No", "", "", "", "145"]], "row_count": 16, "column_count": 5, "numeric_cells": 27, "header_rows": 1, "locator": "section[10]/table-wrap[1]#ijms-17-01808-t002"}}, {"id": "asset:table:pmid:27801851:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:188b6a2cd3fceea60e8b3b351f2a3ffbccd46efd73c0614e1402544f5f75d259", "bytes": 530, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#ijms-17-01808-t003", "version": null, "note": "Primer sequences used for real-time PCR.", "structure": {"pmcid": "PMC5133809", "section_index": 13, "section_title": "4.4. RNA Extraction and Reverse-Transcription PCR from Human Tissue", "row_count": 9, "column_count": 3}, "table": {"label": "Table 3", "caption": "Primer sequences used for real-time PCR.", "rows": [["Gene", "Sequence", "Base"], ["PPIC", "F: AGCAAGTTTCATCGTGTCATCA", "22"], ["R: TGGAAATGTCTCACCATAGATGC", "23"], ["EMP3", "F: GGAGGTCTCTTCTATGCCACC", "21"], ["R: AGGATCTCCTCGGCGTGAAT", "20"], ["CHI3L1", "F: GTGAAGGCGTCTCAAACAGG", "20"], ["R: GAAGCGGTCAAGGGCATCT", "19"], ["GAPDH", "F: GAGTCAACGGATTTGGTCGT", "20"], ["R: TTGATTTTGGAGGGATCTCG", "20"]], "row_count": 9, "column_count": 3, "numeric_cells": 8, "header_rows": 1, "locator": "section[13]/table-wrap[1]#ijms-17-01808-t003"}}], "gaps": ["asset:data:geo:GSE4290 not downloaded", "asset:data:geo:GSE4290 licence not read", "asset:data:geo:GSE4412 not downloaded", "asset:data:geo:GSE4412 licence not read", "asset:data:geo:GSE7696 not downloaded", "asset:data:geo:GSE7696 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "Kaplan-Meier"}}, {"id": "method-2", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "log-rank"}}, {"id": "method-3", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "PPI"}}, {"id": "method-4", "family": null, "specific": null, "label": "Significant analysis of microarray (SAM)", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "reordered", "quote": "“In the current study, microarray data (GSE4412 and GSE7696) downloaded from Gene Expression Omnibus were used to identify differentially expressed prognostic genes (DEPGs) by significant analysis of microarray (SAM) between long-term survivors (>2 years) and short-term survivors (≤2 years).”"}}], "targets": [{"id": "target-published-estimate", "claim_id": "claim-target-result", "operation": "build_graph", "expected_value": 0.05, "unit": "p-value", "tolerance": null, "state": "complete", "note": "The threshold the paper applied to its own result, as the paper states it. A run that reproduces the effect is judged against this threshold."}], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["survival_km"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: kaplan_meier."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE4412", "GSE7696", "GSE4290"], "resolved_accessions": ["GSE4412", "GSE7696", "GSE4290"], "statements": ["Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412."], "basis": "The paper names GSE4412, GSE7696, GSE4290 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["survival_km"], "assets": ["source:pmid:27801851", "data:geo:GSE4290", "asset:table:pmid:27801851:1", "asset:table:pmid:27801851:2", "asset:table:pmid:27801851:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE4290"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:29:59Z", "independence": "same_provider"}, "evidence_check": {"method": "reordered", "availability": null}, "calls": 8, "usage": {"prompt_tokens": 75324, "completion_tokens": 5509, "cached_tokens": 2104}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:27801851", "type": "paper", "label": "pmid:27801851"}, {"id": "source:pmid:27801851", "type": "manuscript", "label": "PMID 27801851 full text"}, {"id": "data:geo:GSE4290", "type": "dataset", "label": "GEO GSE4290"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:27801851", "type": "paper", "label": "pmid:27801851"}, {"id": "source:pmid:27801851", "type": "manuscript", "label": "PMID 27801851 full text"}, {"id": "data:geo:GSE4290", "type": "dataset", "label": "GEO GSE4290"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-27801851", "type": "extraction", "used": ["source:pmid:27801851"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE4290", "type": "accession_resolution", "used": ["data:geo:GSE4290"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:27801851", "parent_hash": "sha256:ae9c08148f7031f3d2e01015ed1fd5b07b13222fddfc4544190680d22baa0f5e", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE4290 licence not read", "asset:data:geo:GSE4290 not downloaded", "asset:data:geo:GSE4412 licence not read", "asset:data:geo:GSE4412 not downloaded", "asset:data:geo:GSE7696 licence not read", "asset:data:geo:GSE7696 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["h clinical parameters. In the current study, microarray data (GSE4412 and GSE7696) downloaded from G", "tic genes (DEPGs) by significant analysis of microarray (SAM) between long-term survivors (>2 years)"], "order_basis": "paper_text_order:402", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["time reverse transcription quantitative PCR (qPCR). Survival value of the common DEPGs was val"], "order_basis": "paper_text_order:892", "id": "assay:2"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["survival_km"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["Kaplan-Meier"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}