Neutrophil-Hepatic Stellate Cell Interactions Promote Fibrosis in Experimental Steatohepatitis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:29552626", "kind": "science-record", "revision": 9, "content_hash": "sha256:8aae2da988ee763a7ae659f35fd18662748696f9a028363428b19d437471fde4", "created_at": "2026-11-01T15:40:32Z", "updated_at": "2026-11-01T22:43:19Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Neutrophil-Hepatic Stellate Cell Interactions Promote Fibrosis in Experimental Steatohepatitis.", "doi": "10.1016/j.jcmgh.2018.01.003", "pmid": "29552626", "authors": ["Zhou Zhou", "Ming-Jiang Xu", "Yan Cai", "Wei Wang", "Joy X Jiang", "Zoltan V Varga", "Dechun Feng", "Pal Pacher", "George Kunos", "Natalie J Torok", "Bin Gao"], "journal": "Cellular and molecular gastroenterology and hepatology", "year": 2018, "abstract": "BACKGROUND & AIMS: Hepatic infiltration of neutrophils is a hallmark of steatohepatitis; however, the role of neutrophils in the progression of steatohepatitis remains unknown.\nMETHODS: A clinically relevant mouse model of steatohepatitis induced by high-fat diet (HFD) plus binge ethanol feeding was used. Liver fibrosis was examined. In vitro cell culture was used to analyze the interaction of hepatic stellate cells (HSCs) and neutrophils.\nRESULTS: HFD plus one binge ethanol (HFD+1B) feeding induced significant hepatic neutrophil infiltration, liver injury, and fibrosis. HFD plus multiple binges of ethanol (HFD+mB) caused more pronounced liver fibrosis. Microarray analyses showed that the most highly activated signaling pathway in this HFD+1B model was related to liver fibrosis and HSC activation. Blockade of chemokine (C-X-C motif) ligand 1 or intercellular adhesion molecule-1 expression reduced hepatic neutrophil infiltration and ameliorated liver injury and fibrosis. Disruption of the p47phox gene (also called neutrophil cytosolic factor 1), a critical component of reactive oxygen species producing nicotinamide adenine dinucleotide phosphate-oxidase in neutrophils, diminished HFD+1B-induced liver injury and fibrosis. Co-culture of HSCs with neutrophils, but not with neutrophil apoptotic bodies, induced HSC activation and prolonged neutrophil survival. Mechanistic studies showed that activated HSCs produce granulocyte-macrophage colony-stimulating factor and interleukin-15 to prolong the survival of neutrophils, which may serve as a positive forward loop to promote liver damage and fibrosis.\nCONCLUSIONS: The current data from a mouse model of HFD plus binge ethanol feeding suggest that obesity and binge drinking synergize to promote liver fibrosis, which is partially mediated via the interaction of neutrophils and HSCs. Microarray data in this article have been uploaded to NCBI's Gene Expression Omnibus (GEO accession number: GSE98153).", "claims": [{"id": "claim-method", "statement": "Data from 2 groups were compared with an unpaired t test. Data from multiple groups were compared with 1-way analysis of variance followed by the Tukey post hoc test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:29552626", "locator": "sections[17] \"Statistical Analysis\" paragraph 2", "quote": "Data from 2 groups were compared with an unpaired t test. Data from multiple groups were compared with 1-way analysis of variance followed by the Tukey post hoc test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Full microarray data have been uploaded to NCBI’s Gene Expression Omnibus (GEO accession number: GSE98153).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:29552626", "locator": "sections[8] \"Microarray Analyses of Mouse Liver Samples\" paragraph 2", "quote": "Full microarray data have been uploaded to NCBI’s Gene Expression Omnibus (GEO accession number: GSE98153)."}], "state": "complete"}, {"id": "claim-target-result", "statement": "Headline result: Obesity and binge drinking synergistically promote liver fibrosis, partially through interactions between neutrophils and hepatic stellate cells. Statistical method: two-group comparisons used an unpaired t test; multiple-group comparisons used one-way analysis of variance followed by the Tukey post hoc test, with P < .05 considered significant. Route to source data: the microarray data were uploaded to NCBI’s Gene Expression Omnibus under accession GSE98153, and all authors had access to the study data.", "kind": "qualitative", "target": null, "evidence": [{"asset": "source:pmid:29552626", "locator": "sections[0] \"Abstract\" paragraph 4", "quote": "The current data from a mouse model of HFD plus binge ethanol feeding suggest that obesity and binge drinking synergize to promote liver fibrosis, which is partially mediated via the interaction of neutrophils and HSCs."}, {"asset": "source:pmid:29552626", "locator": "sections[17] \"Statistical Analysis\" paragraph 2", "quote": "Data are shown as means ± SEM. Data from 2 groups were compared with an unpaired t test. Data from multiple groups were compared with 1-way analysis of variance followed by the Tukey post hoc test. P < .05 was considered a significant difference."}, {"asset": "source:pmid:29552626", "locator": "sections[0] \"Abstract\" paragraph 4", "quote": "Microarray data in this article have been uploaded to NCBI’s Gene Expression Omnibus (GEO accession number: GSE98153)."}, {"asset": "source:pmid:29552626", "locator": "sections[18] \"Data\" paragraph 2", "quote": "All authors had access to the study data and reviewed and approved the final manuscript."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": "Headline result: Obesity and binge drinking synergistically promote liver fibrosis, partially through interactions between neutrophils and hepatic stellate cells. Statistical method: two-group comparisons used an unpaired t test; multiple-group comparisons used one-way analysis of variance followed by the Tukey post hoc test, with P < .05 considered significant. Route to source data: the microarray data were uploaded to NCBI’s Gene Expression Omnibus under accession GSE98153, and all authors had access to the study data.", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:29552626"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE98153"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE98153"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:29552626", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1016/j.jcmgh.2018.01.003", "sha256": "sha256:acb0a1a863a5c4eae2a1cd6682bb9647dbb11ea2547a3df3492e6f3c5b14096c", "bytes": 55043, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1016/j.jcmgh.2018.01.003", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC5852390", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE98153", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE98153", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE98153", "version": null, "note": "Full microarray data have been uploaded to NCBI’s Gene Expression Omnibus (GEO accession number: GSE98153).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Full microarray data have been uploaded to NCBI’s Gene Expression Omnibus (GEO accession number: GSE98153).", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM2588732", "GSM2588733", "GSM2588734", "GSM2588735", "GSM2588736", "GSM2588737", "GSM2588738", "GSM2588739", "GSM2588740", "GSM2588741", "GSM2588742", "GSM2588743", "GSM2588744", "GSM2588745", "GSM2588746", "GSM2588747", "GSM2588748"], "sample_count": 17, "group_sizes": null, "group_sizes_basis": null, "platform": "7202", "taxon": "Mus musculus", "title": "Interaction of neutrophils and hepatic stellate cells promotes fibrosis in a mouse model of steatohepatitis", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:29552626:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d8caa93335b250a9d80f99d0218bdc3d8720b3c8b963801972178cd0dc02dc3a", "bytes": 1365, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#tbl1", "version": null, "note": "Real-Time Quantitative PCR Primer Sequence Used in the Present Study", "structure": {"pmcid": "PMC5852390", "section_index": 16, "section_title": "Real-Time Quantitative PCR", "row_count": 19, "column_count": 3}, "table": {"label": "Table 1", "caption": "Real-Time Quantitative PCR Primer Sequence Used in the Present Study", "rows": [["Gene name", "Forward", "Reverse"], ["Acta2 (encodes α-SMA)", "TCCTGACGCTGAAGTATCCGATA", "GGTGCCAGATCTTTTCCATGTC"], ["collagen 1a1", "TAGGCCATTGTGTATGCAGC", "ACATGTTCAGCTTTGTGGACC"], ["collagen 1a2", "GGTGAGCCTGGTCAAACGG", "ACTGTGTCCTTTCACGCCTTT"], ["collagen 3a1", "TAGGACTGACCAAGGTGGCT", "GGAACCTGGTTTCTTCTCACC"], ["collagen 4a1", "CACATTTTCCACAGCCAGAG", "GTCTGGCTTCTGCTGCTCTT"], ["collagen 5a2", "CATGGAGAAGGTTTCCAAATG", "AAAGCCCAGGAACAAGAGAA"], ["collagen 12a1", "TGAGGTCTGGGTAAAGGCAA", "GTATGAGGTCACCGTCCAGG"], ["Ly6g", "TGCGTTGCTCTGGAGATAGA", "CAGAGTAGTGGGGCAGATG"], ["Csf2 (encodes GM-CSF)", "CTGCTCTTCTCCACGCTACTG", "GAGACTCGCCGGTGTATCC"], ["Csf3 (encodes G-CSF)", "CTGATCTTCTTGCTACTCCCCA", "GGTGTAGTTCAAGTGAGGCAG"], ["IL3", "GGGATACCCACCGTTTAACCA", "AGGTTTACTCTCCGAAAGCTCTT"], ["IL15", "ACATCCATCTCGTGCTACTTGT", "GCCTCTGTTTTAGGGAGACCT"], ["Egf", "AGCATCTCTCGGATTGACCCA", "CCTGTCCCGTTAAGGAAAACTCT"], ["Hgf", "ATGTGGGGGACCAAACTTCTG", "GGATGGCGACATGAAGCAG"], ["IL17a", "TTTAACTCCCTTGGCGCAAAA", "CTTTCCCTCCGCATTGACAC"], ["IL17f", "TGCTACTGTTGATGTTGGGAC", "AATGCCCTGGTTTTGGTTGAA"], ["Ly6g", "TGCGTTGCTCTGGAGATAGA", "CAGAGTAGTGGGGCAGATGG"], ["18s", "GTAACCCGTTGAACCCCATT", "CCATCCAATCGGTAGTAGCG"]], "row_count": 19, "column_count": 3, "numeric_cells": 10, "header_rows": 1, "locator": "section[16]/table-wrap[1]#tbl1"}}], "gaps": ["asset:data:geo:GSE98153 not downloaded", "asset:data:geo:GSE98153 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Data from 2 groups were compared with an unpaired t test. Data from multiple groups were compared with 1-way analysis of variance followed by the Tukey post hoc test."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE98153"], "resolved_accessions": ["GSE98153"], "statements": ["Full microarray data have been uploaded to NCBI’s Gene Expression Omnibus (GEO accession number: GSE98153)."], "basis": "The paper names GSE98153 in NCBI’s Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:29552626", "data:geo:GSE98153", "asset:table:pmid:29552626:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE98153"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:34:15Z", "independence": "same_provider"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 8, "usage": {"prompt_tokens": 114393, "completion_tokens": 2962, "cached_tokens": 1560}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:29552626", "type": "paper", "label": "pmid:29552626"}, {"id": "source:pmid:29552626", "type": "manuscript", "label": "PMID 29552626 full text"}, {"id": "data:geo:GSE98153", "type": "dataset", "label": "GEO GSE98153"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:29552626", "type": "paper", "label": "pmid:29552626"}, {"id": "source:pmid:29552626", "type": "manuscript", "label": "PMID 29552626 full text"}, {"id": "data:geo:GSE98153", "type": "dataset", "label": "GEO GSE98153"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-29552626", "type": "extraction", "used": ["source:pmid:29552626"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE98153", "type": "accession_resolution", "used": ["data:geo:GSE98153"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:29552626", "parent_hash": "sha256:58baff2016486dee9f652aa48adfdd214065ce2f2d04a5f36c60ae3b36c2e082", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE98153 licence not read", "asset:data:geo:GSE98153 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ains unknown. METHODS: A clinically relevant mouse model of steatohepatitis induced by high-fat diet", "brosis. CONCLUSIONS: The current data from a mouse model of HFD plus binge ethanol feeding suggest th", "ains unknown. METHODS: A clinically relevant mouse model of steatohepatitis induced by high-fat", "brosis. CONCLUSIONS: The current data from a mouse model of HFD plus binge ethanol feeding sugg"], "order_basis": "paper_text_order:259", "id": "assay:1"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["D+mB) caused more pronounced liver fibrosis. Microarray analyses showed that the most highly activat", "via the interaction of neutrophils and HSCs. Microarray data in this article have been uploaded to N", "Materials and Methods Microarray Analyses of Mouse Liver Samples Total RNAs w", "bridized to an Agilent 44K mouse 60-meroligo microarray (Agilent Technologies, Santa Clara, CA). The"], "order_basis": "paper_text_order:713", "id": "assay:2"}, {"role": "data_generation", "definition_id": "elisa", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["on Omnibus (GEO accession number: GSE98153). Enzyme-Linked Immunosorbent Assay Analysis of GM-CSF The concentration of GM-C", "pernatant of HSCs was measured with a GM-CSF enzyme-linked immunosorbent assay kit (R&D) according to the manufacturer's in"], "order_basis": "paper_text_order:3105", "id": "assay:3"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Data from 2 groups were compared with an unpaired t test. Data from multiple groups were compared with 1-way analysis of variance followed by the Tukey post hoc test."], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}