Combination of IFITM1 knockdown and radiotherapy inhibits the growth of oral cancer.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:29770536", "kind": "science-record", "revision": 9, "content_hash": "sha256:af10df7c1aebcae49f4b6be5fde6f62c8da484bd9bbf0bb409cf4830575a0b9c", "created_at": "2026-11-01T15:40:33Z", "updated_at": "2026-11-01T22:43:22Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Combination of IFITM1 knockdown and radiotherapy inhibits the growth of oral cancer.", "doi": "10.1111/cas.13640", "pmid": "29770536", "authors": ["Jie Yang", "Lei Li", "Yan Xi", "Ruimei Sun", "Hu Wang", "Yanxin Ren", "Liufang Zhao", "Xiaoli Wang", "Xiaojiang Li"], "journal": "Cancer science", "year": 2018, "abstract": "This research aimed to analyze the effect of IFITM1 on the radioresistance of oral neoplasm. Using a multi-group heat map from GSE9716 analysis of the GEO database, IFITM1 was determined to be a relevant radioresistance gene. The TCGA database was analyzed before the expression of IFITM1 was analyzed. IFITM1 expression was quantified by quantitative RT-PCR and immunohistochemistry in 19 paired oral neoplasm cases. The effects of time and dose of radiation on IFITM1 expression level in CAL27 and TSCC1 cell lines were tested by quantitative RT-PCR. Oral neoplasm cells were transfected with siRNA after radiotherapy to disturb IFITM1 expression. After this, the survival rates, cell apoptosis, caspase-3 viability, expression and γ-H2AX were detected using colony formation, flow cytometry, western blot and immunofluorescence, respectively. Western blot was used for STAT1/2/3/p21-related protein and phosphorylation changes. Finally, an in vivo nude mice tumor model was established to verify the effect of IFITM1 on oral neoplasm cells radioresistance. Through microarray analysis, the head and neck neoplasm radioresistance-related gene IFITM1 was found to be overexpressed. IFITM1 overexpression was verified not only using the TCGA database but also in 19 paired cases of oral neoplasm tissues and cells. With increases of dose and time of radiation, the expression of IFITM1 was increased in CAL27 and TSCC1 cell lines. Furthermore, si-IFITM1 may restrain cell proliferation, DNA damage and cell apoptosis in oral neoplasm cell lines. Finally, pSTAT1/2/p21 was found to be upregulated while pSTAT3/p-p21 was downregulated due to IFITM1 inhibition after radiotherapy. The evidence suggested that IFITM1 in combination with radiotherapy can inhibit oral neoplasm cells.", "claims": [{"id": "claim-method", "statement": "An unpaired student's t test was used to examine differences between groups. Differences among the groups of samples were assessed by one‐way ANOVA.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:29770536", "locator": "sections[16] \"Statistical analysis\" paragraph 2", "quote": "An unpaired student's t test was used to examine differences between groups. Differences among the groups of samples were assessed by one‐way ANOVA."}], "state": "complete"}, {"id": "claim-data-access", "statement": "GSE9716 containing 38 samples (from GSM245389 to GSM245426) was used to detect differentially‐expressed genes in radioresistant and radiosensitive human head and neck tumors before and after irradiation.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:29770536", "locator": "sections[15] \"Microarray\" paragraph 2", "quote": "GSE9716 containing 38 samples (from GSM245389 to GSM245426) was used to detect differentially‐expressed genes in radioresistant and radiosensitive human head and neck tumors before and after irradiation."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:29770536"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE9716"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE9716"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:29770536", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1111/cas.13640", "sha256": "sha256:7461304302252a74164f204905c418a39fc115837080dfca301d640d4675c6bc", "bytes": 44940, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1111/cas.13640", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6172064", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE9716", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE9716", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE9716", "version": null, "note": "GSE9716 containing 38 samples (from GSM245389 to GSM245426) was used to detect differentially‐expressed genes in radioresistant and radiosensitive human head and neck tumors before and after irradiation.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSE9716 containing 38 samples (from GSM245389 to GSM245426) was used to detect differentially‐expressed genes in radioresistant and radiosensitive human head and neck tumors before and after irradiation.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM245389", "GSM245390", "GSM245391", "GSM245392", "GSM245393", "GSM245394", "GSM245395", "GSM245396", "GSM245397", "GSM245398", "GSM245399", "GSM245400", "GSM245401", "GSM245402", "GSM245403", "GSM245404", "GSM245405", "GSM245406", "GSM245407", "GSM245408", "GSM245409", "GSM245410", "GSM245411", "GSM245412", "GSM245413", "GSM245414", "GSM245415", "GSM245416", "GSM245417", "GSM245418", "GSM245419", "GSM245420", "GSM245421", "GSM245422", "GSM245423", "GSM245424", "GSM245425", "GSM245426"], "sample_count": 38, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Radioresistant and radiosensitive tumors and cell lines", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:29770536:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:685569ccc46586933f4c4f2e7e400e4a7b59f6f3ec49dc8457a3dc6cb1957188", "bytes": 325, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#cas13640-tbl-0001", "version": null, "note": "siRNA sequences designed by BLOCK‐iT RNAi designer", "structure": {"pmcid": "PMC6172064", "section_index": 5, "section_title": "Cell transfection", "row_count": 3, "column_count": 2}, "table": {"label": "Table 1", "caption": "siRNA sequences designed by BLOCK‐iT RNAi designer", "rows": [["Gene", "Sequence (5′‐3′)"], ["SiIFITM1", "TGGTATTCGGCTCTGTGACAGTCTA"], ["SiNC", "TGGGCTTCTCGGTGTGACATATCTA"]], "row_count": 3, "column_count": 2, "numeric_cells": 1, "header_rows": 1, "locator": "section[5]/table-wrap[1]#cas13640-tbl-0001"}}, {"id": "asset:table:pmid:29770536:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ec4b406e1471292085be74b118446276d192f4681eb77b6fb75776d3ebc3bdeb", "bytes": 409, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#cas13640-tbl-0002", "version": null, "note": "Primers for quantitative RT‐PCR", "structure": {"pmcid": "PMC6172064", "section_index": 7, "section_title": "Extraction of RNA and quantitative RT‐PCR", "row_count": 5, "column_count": 2}, "table": {"label": "Table 2", "caption": "Primers for quantitative RT‐PCR", "rows": [["Gene name", "Primer sequence (5′‐3′)"], ["IFITM1 forward", "TCGCCTACTCCGTGAAGTCTA"], ["IFITM1 reverse", "TGTCACAGAGCCGAATACCAG"], ["GAPDH forward", "TATAAATTGAGCCCGCAGCC"], ["GAPDH reverse", "TACGACCAAATCCGTTGACTC"]], "row_count": 5, "column_count": 2, "numeric_cells": 1, "header_rows": 1, "locator": "section[7]/table-wrap[1]#cas13640-tbl-0002"}}, {"id": "asset:table:pmid:29770536:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:895546a741cba8d2807ac60ba0636757e71c3bee4e0e721f0de50d53ef56cff8", "bytes": 870, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#cas13640-tbl-0003", "version": null, "note": "Antibodies used for western blot, immunohistochemical staining and immunofluorescent staining", "structure": {"pmcid": "PMC6172064", "section_index": 13, "section_title": "Western blot", "row_count": 15, "column_count": 4}, "table": {"label": "Table 3", "caption": "Antibodies used for western blot, immunohistochemical staining and immunofluorescent staining", "rows": [["Protein", "Catalog", "Dilution", "Company"], ["IFITM1", "ab224063", "1/100", "Abcam"], ["Cleaved caspase3", "#9661", "1/500", "CST"], ["γH2AX", "ab2893", "1/500", "Abcam"], ["GAPDH", "ab181602", "1/10 000", "Abcam"], ["p‐STAT1(S727)", "ab109461", "1/5000", "Abcam"], ["STAT1", "ab31369", "1/1000", "Abcam"], ["p‐STAT2(Y690)", "ab53132", "1/3000", "Abcam"], ["STAT2", "ab134192", "1/2000", "Abcam"], ["p‐STAT3(S727)", "ab32143", "1/1000", "Abcam"], ["STAT3", "ab32500", "1/2000", "Abcam"], ["p‐p21(T145)", "ab47300", "1/200", "Abcam"], ["p21", "ab109520", "1/2000", "Abcam"], ["IgG‐HRP", "ab8227", "1/2000", "Abcam"], ["IgG‐Cy3", "ab6939", "1/500", "Abcam"]], "row_count": 15, "column_count": 4, "numeric_cells": 33, "header_rows": 1, "locator": "section[13]/table-wrap[1]#cas13640-tbl-0003"}}], "gaps": ["asset:data:geo:GSE9716 not downloaded", "asset:data:geo:GSE9716 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "An unpaired student's t test was used to examine differences between groups. Differences among the groups of samples were assessed by one‐way ANOVA."}}, {"id": "method-2", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE9716"], "resolved_accessions": ["GSE9716"], "statements": ["GSE9716 containing 38 samples (from GSM245389 to GSM245426) was used to detect differentially‐expressed genes in radioresistant and radiosensitive human head and neck tumors before and after irradiation."], "basis": "The paper names GSE9716 in GEO and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:29770536", "data:geo:GSE9716", "asset:table:pmid:29770536:1", "asset:table:pmid:29770536:2", "asset:table:pmid:29770536:3"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE9716"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:11:41Z", "independence": "same_provider"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 34882, "completion_tokens": 998, "cached_tokens": 11912}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:29770536", "type": "paper", "label": "pmid:29770536"}, {"id": "source:pmid:29770536", "type": "manuscript", "label": "PMID 29770536 full text"}, {"id": "data:geo:GSE9716", "type": "dataset", "label": "GEO GSE9716"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:29770536", "type": "paper", "label": "pmid:29770536"}, {"id": "source:pmid:29770536", "type": "manuscript", "label": "PMID 29770536 full text"}, {"id": "data:geo:GSE9716", "type": "dataset", "label": "GEO GSE9716"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-29770536", "type": "extraction", "used": ["source:pmid:29770536"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE9716", "type": "accession_resolution", "used": ["data:geo:GSE9716"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:29770536", "parent_hash": "sha256:7e1609034c7261ee43f0a2df47a391d24b24616c081bc5810b18891651d6624c", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE9716 licence not read", "asset:data:geo:GSE9716 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["Combination of IFITM1 knockdown and radiotherapy inhibits the growth of oral", "uantitative RT-PCR. Oral neoplasm cells were transfected with siRNA after radiotherapy to disturb IFI", "R. Oral neoplasm cells were transfected with siRNA after radiotherapy to disturb IFITM1 express"], "order_basis": "paper_text_order:0", "id": "assay:1"}, {"role": "data_generation", "definition_id": "ihc", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["on was quantified by quantitative RT-PCR and immunohistochemistry in 19 paired oral neoplasm cases. The effect", "formation, flow cytometry, western blot and immunofluorescence, respectively. Western blot was used for STA"], "order_basis": "paper_text_order:403", "id": "assay:2"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ession. After this, the survival rates, cell apoptosis, caspase-3 viability, expression and γ-H2AX", "rain cell proliferation, DNA damage and cell apoptosis in oral neoplasm cell lines. Finally, pSTAT1", "er this, the survival rates, cell apoptosis, caspase-3 viability, expression and γ-H2AX were dete"], "order_basis": "paper_text_order:727", "id": "assay:3"}, {"role": "data_generation", "definition_id": "flow_cytometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["γ-H2AX were detected using colony formation, flow cytometry, western blot and immunofluorescence, respec"], "order_basis": "paper_text_order:819", "id": "assay:4"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["cted using colony formation, flow cytometry, western blot and immunofluorescence, respectively. Wester", "n blot and immunofluorescence, respectively. Western blot was used for STAT1/2/3/p21-related protein a"], "order_basis": "paper_text_order:835", "id": "assay:5"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["ein and phosphorylation changes. Finally, an in vivo nude mice tumor model was established to ver"], "order_basis": "paper_text_order:983", "id": "assay:6"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["oral neoplasm cells radioresistance. Through microarray analysis, the head and neck neoplasm radiore"], "order_basis": "paper_text_order:1108", "id": "assay:7"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["An unpaired student's t test was used to examine differences between groups. Differences among the groups of samples were assessed by one‐way ANOVA."], "order_basis": "consumes_earlier_output", "id": "assay:8"}]}