Application of Weighted Gene Co-Expression Network Analysis to Explore the Key Genes in Alzheimer's Disease.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:30124448", "kind": "science-record", "revision": 5, "content_hash": "sha256:8b82fe6a13a90192d5118d2fc3c8fed4ba93c193308183b4cc73c1803adecfa5", "created_at": "2026-11-01T15:40:36Z", "updated_at": "2026-11-01T21:21:36Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Application of Weighted Gene Co-Expression Network Analysis to Explore the Key Genes in Alzheimer's Disease.", "doi": "10.3233/JAD-180400", "pmid": "30124448", "authors": ["Jia-Wei Liang", "Zheng-Yu Fang", "Yong Huang", "Zhen-Yu Liuyang", "Xiao-Lin Zhang", "Jing-Lin Wang", "Hui Wei", "Jian-Zhi Wang", "Xiao-Chuan Wang", "Ji Zeng", "Rong Liu"], "journal": "Journal of Alzheimer's disease : JAD", "year": 2018, "abstract": "BACKGROUND: Weighted co-expression network analysis (WGCNA) is a powerful systems biology method to describe the correlation of gene expression based on the microarray database, which can be used to facilitate the discovery of therapeutic targets or candidate biomarkers in diseases.\nOBJECTIVE: To explore the key genes in the development of Alzheimer's disease (AD) by using WGCNA.\nMETHODS: The whole gene expression data GSE1297 from AD and control human hippocampus was obtained from the GEO database in NCBI. Co-expressed genes were clustered into different modules. Modules of interest were identified through calculating the correlation coefficient between the module and phenotypic traits. GO and pathway enrichment analyses were conducted, and the central players (key hub genes) within the modules of interest were identified through network analysis. The expression of the identified key genes was confirmed in AD transgenic mice through using qRT-PCR.\nRESULTS: Two modules were found to be associated with AD clinical severity, which functioning mainly in mineral absorption, NF-κB signaling, and cGMP-PKG signaling pathways. Through analysis of the two modules, we found that metallothionein (MT), Notch2, MSX1, ADD3, and RAB31 were highly correlated with AD phenotype. Increase in expression of these genes was confirmed in aged AD transgenic mice.\nCONCLUSION: WGCNA analysis can be used to analyze and predict the key genes in AD. MT1, MT2, MSX1, NOTCH2, ADD3, and RAB31 are identified to be the most relevant genes, which may be potential targets for AD therapy.", "claims": [{"id": "claim-method", "statement": "Weighted gene co-expression network analysis (WGCNA) is a popular systems biology method used to describe the correlation of gene expression based on the microarray database [2].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30124448", "locator": "sections[1] \"INTRODUCTION\" paragraph 3", "quote": "Weighted gene co-expression network analysis (WGCNA) is a popular systems biology method used to describe the correlation of gene expression based on the microarray database [2]."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The data used in this paper was obtained from the GEO database in NCBI (Gene Expression Omnibus, http://www.ncbi.nlm.gov/geo), and the data entry number is GSE1297.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30124448", "locator": "sections[3] \"Data acquisition and preprocessing\" paragraph 2", "quote": "The data used in this paper was obtained from the GEO database in NCBI (Gene Expression Omnibus, http://www.ncbi.nlm.gov/geo), and the data entry number is GSE1297."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:30124448"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE1297"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE1297"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:30124448", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3233/JAD-180400", "sha256": "sha256:764a999bf7ac46cd9044ebeb0a33fe391c88b08284efd522ac077652e322a075", "bytes": 33049, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3233/JAD-180400", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6218130", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE1297", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE1297", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE1297", "version": null, "note": "The data used in this paper was obtained from the GEO database in NCBI (Gene Expression Omnibus, http://www.ncbi.nlm.gov/geo), and the data entry number is GSE1297.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data used in this paper was obtained from the GEO database in NCBI (Gene Expression Omnibus, http://www.ncbi.nlm.gov/geo), and the data entry number is GSE1297.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM21203", "GSM21204", "GSM21205", "GSM21206", "GSM21207", "GSM21208", "GSM21209", "GSM21210", "GSM21211", "GSM21212", "GSM21213", "GSM21214", "GSM21215", "GSM21216", "GSM21217", "GSM21218", "GSM21219", "GSM21220", "GSM21221", "GSM21222", "GSM21223", "GSM21224", "GSM21225", "GSM21226", "GSM21227", "GSM21228", "GSM21229", "GSM21230", "GSM21231", "GSM21232", "GSM21233"], "sample_count": 31, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Incipient Alzheimer's Disease: Microarray Correlation Analyses", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:30124448:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d1b16baf648d885b7e2a231b6fae120b54720e78f1c715e9a21a8e98ab78be03", "bytes": 841, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#jad-65-jad180400-t001", "version": null, "note": "PCR primers for quantitative real-time PCR", "structure": {"pmcid": "PMC6218130", "section_index": 7, "section_title": "Total RNA isolation and qRT-PCR", "row_count": 11, "column_count": 3}, "table": {"label": "Table 1", "caption": "PCR primers for quantitative real-time PCR", "rows": [["Gene", "Primer sequence (5’→*3’)"], ["ADD3", "F: TCGACCATGCAGTTTGACGA", "R:CACTCTGCGGTGACTGAGTT"], ["MT1", "F:CTCCTGCAAGAAGAGCTGCT", "R:CACAGCACGTGCACTTGTC"], ["MT2", "F:CTCCGATGGATCCTGCTCCT", "R:GGATGTAACCTGCCCAAGCT"], ["NOTCH2", "F:CTCCGATGCCACATCCTCTC", "R:GGATGTAACCTGCCCAAGCT"], ["RAB31", "F:CGGGAGCTCAAAGTGTGTCT", "R:CTGCAGCAGATCCTCGGTAG"], ["EHD1", "F:GTCCTTGAGTGGTTCGCAGA", "R:TAGACTCTGACCACCTCGGG"], ["VCAN", "F:GTTCCACATCACTGCTCCCA", "R:TAGACCTCCTCCACACTGGG"], ["MSX1", "F:AGTTCCGCCAGAAGCAGTAC", "R:GGACCGCCAAGAGGAAAAGA"], ["HEY2", "F:AGCTGCTTTCCACCATCTCC", "R:ACAGTGGCCGAAAGAGACAG"], ["EHD3", "F:TCCAGCCACTGAAGAGCAAG", "R:ATACATAGGCTTGTCCCGCG"]], "row_count": 11, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[7]/table-wrap[1]#jad-65-jad180400-t001"}}, {"id": "asset:table:pmid:30124448:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9aebe1a7f411d650bd83585a403ee5963d5b3e496a3d045c4a5669ad09fa3e7d", "bytes": 463, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#jad-65-jad180400-t002", "version": null, "note": "Module and the number of genes in each module", "structure": {"pmcid": "PMC6218130", "section_index": 10, "section_title": "Gene co-expression network construction and module identification", "row_count": 3, "column_count": 7}, "table": {"label": "Table 2", "caption": "Module and the number of genes in each module", "rows": [["Black 217", "Blue 936", "Brown 426", "Cyan 150", "Green 255", "Greenyellow 87", "Gray 137"], ["Grey60 32", "Lightcyan 39", "Lightgreen 35", "Magenta 140", "Turquoise1626", "Midnightblue 149", "Yellow281"], ["Purple 109", "Red 230", "Pink 199", "Salmon 50", "Tan 54"]], "row_count": 3, "column_count": 7, "numeric_cells": 19, "header_rows": 0, "locator": "section[10]/table-wrap[1]#jad-65-jad180400-t002"}}, {"id": "asset:table:pmid:30124448:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:58aa2c9e7882bf19c9c2e14c1eb39c49c62713706fe472e5b62a3d5e3e69c373", "bytes": 1102, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#jad-65-jad180400-t003", "version": null, "note": "KEGG pathway analysis of salmon module", "structure": {"pmcid": "PMC6218130", "section_index": 11, "section_title": "Finding module of interest and functional annotation", "row_count": 11, "column_count": 5}, "table": {"label": "Table 3", "caption": "KEGG pathway analysis of salmon module", "rows": [["geneset", "description", "C", "O", "P Value"], ["hsa04022", "cGMP-PKG signaling pathway - Homo sapiens (human)", "168", "3", "0.010725"], ["hsa05412", "Arrhythmogenic right ventricular cardiomyopathy (ARVC) - Homo sapiens (human)", "74", "2", "0.017684"], ["hsa04540", "Gap junction - Homo sapiens (human)", "88", "2", "0.024487"], ["hsa04970", "Salivary secretion - Homo sapiens (human)", "90", "2", "0 025534"], ["hsa04974", "Protein digestion and absorption - Homo sapiens (human)", "90", "2", "0.025534"], ["hsa04713", "Circadian entrainment - Homo sapiens (human)", "96", "2", "0.028785"], ["hsa04010", "MARK signaling pathway - Homo sapiens (human)", "255", "3", "0.03234"], ["hsa04725", "Cholinergic synapse - Homo sapiens (human)", "111", "2", "0.037592"], ["hsa04724", "Glutamatergic synapse - Homo sapiens (human)", "114", "2", "0.039465"], ["hsa04919", "Thyroid hormone signaling pathway - Homo sapiens (human)", "118", "2", "0.042017"]], "row_count": 11, "column_count": 5, "numeric_cells": 40, "header_rows": 1, "locator": "section[11]/table-wrap[1]#jad-65-jad180400-t003"}}, {"id": "asset:table:pmid:30124448:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d01fffb82bf3087c7c43f2261c3d76aadc148f140855d38abf251ea9abedf114", "bytes": 743, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[2]#jad-65-jad180400-t004", "version": null, "note": "KEGG pathway analysis of lightgreen module", "structure": {"pmcid": "PMC6218130", "section_index": 11, "section_title": "Finding module of interest and functional annotation", "row_count": 7, "column_count": 5}, "table": {"label": "Table 4", "caption": "KEGG pathway analysis of lightgreen module", "rows": [["geneset", "description", "C", "O", "P Value"], ["hsa04978", "Mineral absorption - Homo sapiens (human)", "52", "9", "1.23E-14"], ["hsa04064", "NF-kappa B signaling pathway - Homo sapiens (human)", "95", "2", "0.033744"], ["hsa00565", "Ether lipid metabolism - Homo sapiens (human)", "45", "1", "0.12943879"], ["hsa05030", "Cocaine addiction - Homo sapiens (human)", "49", "1", "0.14013605"], ["hsa04720", "Long-term potentiation - Homo sapiens (human)", "67", "1", "0.18674032"], ["hsa05031", "Amphetamine addiction - Homo sapiens (human)", "68", "1", "0.18925744"]], "row_count": 7, "column_count": 5, "numeric_cells": 24, "header_rows": 1, "locator": "section[11]/table-wrap[2]#jad-65-jad180400-t004"}}], "gaps": ["asset:data:geo:GSE1297 not downloaded", "asset:data:geo:GSE1297 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}, {"id": "method-2", "family": null, "specific": null, "label": "Weighted co-expression network analysis (WGCNA)", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Weighted gene co-expression network analysis (WGCNA) is a popular systems biology method used to describe the correlation of gene expression based on the microarray database [2]."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: pathway_enrichment."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE1297"], "resolved_accessions": ["GSE1297"], "statements": ["The data used in this paper was obtained from the GEO database in NCBI (Gene Expression Omnibus, http://www.ncbi.nlm.gov/geo), and the data entry number is GSE1297."], "basis": "The paper names GSE1297 in GEO database in NCBI (Gene Expression Omnibus) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["pathway_enrich"], "assets": ["source:pmid:30124448", "data:geo:GSE1297", "asset:table:pmid:30124448:1", "asset:table:pmid:30124448:2", "asset:table:pmid:30124448:3", "asset:table:pmid:30124448:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE1297"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:12:12Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 26055, "completion_tokens": 940, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:30124448", "type": "paper", "label": "pmid:30124448"}, {"id": "source:pmid:30124448", "type": "manuscript", "label": "PMID 30124448 full text"}, {"id": "data:geo:GSE1297", "type": "dataset", "label": "GEO GSE1297"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:30124448", "type": "paper", "label": "pmid:30124448"}, {"id": "source:pmid:30124448", "type": "manuscript", "label": "PMID 30124448 full text"}, {"id": "data:geo:GSE1297", "type": "dataset", "label": "GEO GSE1297"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-30124448", "type": "extraction", "used": ["source:pmid:30124448"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE1297", "type": "accession_resolution", "used": ["data:geo:GSE1297"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:30124448", "parent_hash": "sha256:58be513b0c5260945727abcb86f9a75882a48790678c6689969b99230025aa40", "fork_of": null, "generation": 4}, "gaps": ["asset:data:geo:GSE1297 licence not read", "asset:data:geo:GSE1297 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["correlation of gene expression based on the microarray database, which can be used to facilitate th"], "order_basis": "paper_text_order:222", "id": "assay:1"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["pathway enrichment"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}