Circular RNAs hsa_circ_0032462, hsa_circ_0028173, hsa_circ_0005909 are predicted to promote CADM1 expression by functioning as miRNAs sponge in human osteosarcoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:30153287", "kind": "science-record", "revision": 7, "content_hash": "sha256:7ed937ba75d4432cb7407c7397e1e9e1c90d76a56436ee077d3734f24d73dc17", "created_at": "2026-11-01T15:40:36Z", "updated_at": "2026-11-01T22:00:00Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Circular RNAs hsa_circ_0032462, hsa_circ_0028173, hsa_circ_0005909 are predicted to promote CADM1 expression by functioning as miRNAs sponge in human osteosarcoma.", "doi": "10.1371/journal.pone.0202896", "pmid": "30153287", "authors": ["Gaoyang Chen", "Qingyu Wang", "Qiwei Yang", "Zhaoyan Li", "Zhenwu Du", "Ming Ren", "Haiyue Zhao", "Yang Song", "Guizhen Zhang"], "journal": "PloS one", "year": 2018, "abstract": "BACKGROUND: Osteosarcoma (OS) is a primary malignant bone tumor with a high fatality rate. Many circRNAs have been proved to play important roles in the pathogenesis of some diseases. However, the occurrence of circRNAs in OS remains little known.\nMETHODS: The circular RNA (circRNA) expression file GSE96964 dataset, which included seven osteosarcoma cell lines and one control sample (osteoblast cell line), was downloaded from the Gene Expression Omnibus (GEO) database to explore the potential function of circRNAs in osteosarcoma by competing endogenous RNA (ceRNA) analysis. Three gene expression profiles of OS were downloaded from GEO database and then used for the pathway enrichment analysis, Venn analysis and protein-protein interaction (PPI) network analysis. Real-time qPCR validation and RNA interference were conducted to verify our prediction.\nRESULTS: Differentially expressed circRNAs between OS and control, including 8 up-regulated and 102 down-regulated circRNAs, were generated and ceRNA analysis for 5 most up-regulated or 5 most down-regulated circRNAs in OS were then performed. The pathway enrichment analysis of gene expression profiles indicated differentially expressed genes (DEGs) of three gene profiles significantly enriched in cell cycle pathway, cell adhesion molecules (CAMs) pathway, oxidative phosphorylation pathway, cytokine-cytokine receptor interaction pathway, p53 signaling pathway and proteoglycans in cancer pathway, which were critical important pathways in the pathogenesis of OS. The Venn analysis showed that 2 (one is a pseudogene) up-regulated and 39 down-regulated DEGs were co-expressed in all three gene profiles. Then PPI networks of 41 co-expressed DEGs (up- and down-regulated DEGs) were constructed to predict their functions using the GeneMANIA. The expression levels of these related RNAs also matched our predictions really well.\nCONCLUSION: Ultimately, we found cell adhesion molecule 1 (CADM1) gene was not only a co-expression mRNA of the three mRNA expression profiles of OS, but also are predicted to be regulated by hsa_circ_0032462, hsa_circ_0028173, hsa_circ_0005909 by functioning as miRNAs 'Sponge' in human osteosarcoma. These over-expressed circRNAs may result in the over expression of CADM1 which promote the development of OS. We envision this discovery of these important moleculars, incuding hsa_circ_0032462, hsa_circ_0028173, hsa_circ_0005909 and CADM1 may lead to further development of new concepts, thus allowing for more opportunities in diagnosis and therapy of OS.", "claims": [{"id": "claim-method", "statement": "The adjust P values were utilized to reduce the false positive rate using Benjamini and Hochberg false discovery rate method by default [14].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30153287", "locator": "sections[4] \"Differential expression analysis\" paragraph 2", "quote": "The adjust P values were utilized to reduce the false positive rate using Benjamini and Hochberg false discovery rate method by default [14]."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Our data are all contained within the paper.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30153287", "locator": "sections[23] \"Data Availability\" paragraph 2", "quote": "Our data are all contained within the paper."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:30153287"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE33382"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE33382"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:30153287", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1371/journal.pone.0202896", "sha256": "sha256:8c181ec4ceb3220334737d55688bcef33d4f0c1ca931f4cc2e603238e3096bbd", "bytes": 45306, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1371/journal.pone.0202896", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6112665", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE33382", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE33382", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE33382", "version": null, "note": "Our data are all contained within the paper.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Our data are all contained within the paper.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM825623", "GSM825624", "GSM825625", "GSM825626", "GSM825627", "GSM825628", "GSM825629", "GSM825630", "GSM825631", "GSM825632", "GSM825633", "GSM825634", "GSM825635", "GSM825636", "GSM825637", "GSM825638", "GSM825639", "GSM825640", "GSM825641", "GSM825642", "GSM825643", "GSM825644", "GSM825645", "GSM825646", "GSM825647", "GSM825648", "GSM825649", "GSM825650", "GSM825651", "GSM825652", "GSM825653", "GSM825654", "GSM825655", "GSM825656", "GSM825657", "GSM825658", "GSM825659", "GSM825660", "GSM825661", "GSM825662", "GSM825663", "GSM825664", "GSM825665", "GSM825666", "GSM825667", "GSM825668", "GSM825669", "GSM825670", "GSM825671", "GSM825672", "GSM825673", "GSM825674", "GSM825675", "GSM825676", "GSM825677", "GSM825678", "GSM825679", "GSM825680", "GSM825681", "GSM825682", "GSM825683", "GSM825684", "GSM825685", "GSM825686", "GSM825687", "GSM825688", "GSM825689", "GSM825690", "GSM825691", "GSM825692", "GSM825693", "GSM825694", "GSM825695", "GSM825696", "GSM825697", "GSM825698", "GSM825699", "GSM825700", "GSM825701", "GSM825702", "GSM825703", "GSM825704", "GSM825705", "GSM825706", "GSM825707", "GSM825708", "GSM825709"], "sample_count": 87, "group_sizes": null, "group_sizes_basis": null, "platform": "10295", "taxon": "Homo sapiens", "title": "Genome-wide gene expression analysis of high-grade osteosarcoma", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE36001", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE36001", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE36001", "version": null, "note": "Our data are all contained within the paper.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Our data are all contained within the paper.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM879156", "GSM879157", "GSM879158", "GSM879159", "GSM879160", "GSM879161", "GSM879162", "GSM879163", "GSM879164", "GSM879165", "GSM879166", "GSM879167", "GSM879168", "GSM879169", "GSM879170", "GSM879171", "GSM879172", "GSM879173", "GSM879174", "GSM879175", "GSM879176", "GSM879177", "GSM879178", "GSM879179", "GSM879180"], "sample_count": 25, "group_sizes": null, "group_sizes_basis": null, "platform": "6102", "taxon": "Homo sapiens", "title": "Integrative analysis reveals relationships of genetic and epigenetic alterations in osteosarcoma [gene expression]", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE42352", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE42352", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE42352", "version": null, "note": "Our data are all contained within the paper.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Our data are all contained within the paper.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1038236", "GSM1038237", "GSM1038238", "GSM1038239", "GSM1038240", "GSM1038241", "GSM1038242", "GSM1038243", "GSM1038244", "GSM1038245", "GSM1038246", "GSM1038247", "GSM1038248", "GSM1038249", "GSM1038250", "GSM1038251", "GSM1038252", "GSM1038253", "GSM1038254", "GSM717846", "GSM717847", "GSM717848", "GSM717849", "GSM717850", "GSM717851", "GSM717852", "GSM717853", "GSM717854", "GSM717855", "GSM717856", "GSM717857", "GSM825623", "GSM825624", "GSM825625", "GSM825626", "GSM825627", "GSM825628", "GSM825629", "GSM825630", "GSM825631", "GSM825632", "GSM825633", "GSM825634", "GSM825635", "GSM825636", "GSM825637", "GSM825638", "GSM825639", "GSM825640", "GSM825641", "GSM825642", "GSM825643", "GSM825644", "GSM825645", "GSM825646", "GSM825647", "GSM825648", "GSM825649", "GSM825650", "GSM825651", "GSM825652", "GSM825653", "GSM825654", "GSM825655", "GSM825656", "GSM825657", "GSM825658", "GSM825659", "GSM825660", "GSM825661", "GSM825662", "GSM825663", "GSM825664", "GSM825665", "GSM825666", "GSM825667", "GSM825668", "GSM825669", "GSM825670", "GSM825671", "GSM825672", "GSM825673", "GSM825674", "GSM825675", "GSM825676", "GSM825677", "GSM825678", "GSM825679", "GSM825680", "GSM825681", "GSM825682", "GSM825683", "GSM825684", "GSM825685", "GSM825686", "GSM825687", "GSM825688", "GSM825689", "GSM825690", "GSM825691", "GSM825692", "GSM825693", "GSM825694", "GSM825695", "GSM825696", "GSM825697", "GSM825698", "GSM825699", "GSM825700", "GSM825701", "GSM825702", "GSM825703", "GSM825704", "GSM825705", "GSM825706", "GSM825707", "GSM825708", "GSM825709"], "sample_count": 118, "group_sizes": null, "group_sizes_basis": null, "platform": "10295", "taxon": "Homo sapiens", "title": "Genome-wide gene expression profiling of mesenchymal stem cells, osteosarcoma cells, and osteosarcoma cell lines.", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE96964", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE96964", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE96964", "version": null, "note": "Our data are all contained within the paper.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Our data are all contained within the paper.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2546888", "GSM2546889", "GSM2546890", "GSM2546891", "GSM2546892", "GSM2546893", "GSM2546894", "GSM2546895"], "sample_count": 8, "group_sizes": null, "group_sizes_basis": null, "platform": "19978", "taxon": "Homo sapiens", "title": "Microarray expression profile and functional analysis of circular RNAs in osteosarcoma", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:30153287:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:45bb6f203706a2589831ac4d63a46aa7562f3cb75f4463ba7dcce26758fab5e0", "bytes": 476, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#pone.0202896.t001", "version": null, "note": "The information of expression profiles.", "structure": {"pmcid": "PMC6112665", "section_index": 3, "section_title": "Microarray data", "row_count": 5, "column_count": 5}, "table": {"label": "Table 1", "caption": "The information of expression profiles.", "rows": [["", "Series", "Platforms", "OS cell lines/ biopsies", "Osteoblast cell lines"], ["circRNA profile", "GSE96964", "GPL19978", "7", "1"], ["gene profile 1", "GSE42352", "GPL10295", "19", "3"], ["gene profile 2", "GSE33382", "GPL10295", "84", "3"], ["gene profile 3", "GSE36001", "GPL6102", "19", "2"]], "row_count": 5, "column_count": 5, "numeric_cells": 19, "header_rows": 1, "locator": "section[3]/table-wrap[1]#pone.0202896.t001"}}, {"id": "asset:table:pmid:30153287:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:303aae7a383af96357ec985fc8b9ad14b811a66630f6d0149139e058bbe6fd49", "bytes": 678, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#pone.0202896.t002", "version": null, "note": "The primers of circRNAs and mRNA.", "structure": {"pmcid": "PMC6112665", "section_index": 10, "section_title": "Quantitative real-time PCR analysis and RNA interference", "row_count": 6, "column_count": 3}, "table": {"label": "Table 2", "caption": "The primers of circRNAs and mRNA.", "rows": [["Gene", "Primer sequences"], ["hsa_circ_0032462", "F: 5’- TGAAACTGGATGAACAAGGGAG-3’", "R: 5’- GCCGTCTGTGCCAACAAC-3’"], ["hsa_circ_0028173", "F: 5’- TCCGCTACCTCATCTCGT-3’", "R: 5’- GTTGCTACCACCACTCCC-3’"], ["hsa_circ_0005909", "F: 5’- GTATCCACTTGCCCTTTA -3’", "R: 5’- TTACTCCAGCCTGTCTC -3’"], ["CADM1", "F: 5’- CTGTGATTCAGCTACTGAATC -3’", "R: 5’- TAGAAAAATTCAGCAACTGAAAC -3’"], ["GAPDH", "F: 5’- CGGACCAATACGACCAAATCCG-3’", "R: 5’- AGCCACATCGCTCAGACACC-3’"]], "row_count": 6, "column_count": 3, "numeric_cells": 13, "header_rows": 1, "locator": "section[10]/table-wrap[1]#pone.0202896.t002"}}, {"id": "asset:table:pmid:30153287:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:73c503aed6be55b1b6029416cfdd94205a2b0d4ab2fe8e74383a0007729ca0ad", "bytes": 442, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#pone.0202896.t003", "version": null, "note": "The differentially expressed circRNAs and genes of the downloaded expression profiles.", "structure": {"pmcid": "PMC6112665", "section_index": 13, "section_title": "Differentially expressed circRNA and genes", "row_count": 5, "column_count": 4}, "table": {"label": "Table 3", "caption": "The differentially expressed circRNAs and genes of the downloaded expression profiles.", "rows": [["", "Up regulation", "Down regulation", "Total"], ["circRNA profile", "8", "102", "110"], ["gene profile 1", "456", "536", "991"], ["gene profile 2", "321", "524", "845"], ["gene profile 3", "67", "188", "255"]], "row_count": 5, "column_count": 4, "numeric_cells": 15, "header_rows": 1, "locator": "section[13]/table-wrap[1]#pone.0202896.t003"}}, {"id": "asset:table:pmid:30153287:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:62e8528e37e1e8240a4388e0e84de48378188a92470b0dbe2e2fa646a8ea64c9", "bytes": 577, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#pone.0202896.t004", "version": null, "note": "The co-expression DEGs of three gene expression profiles.", "structure": {"pmcid": "PMC6112665", "section_index": 16, "section_title": "The co-expressed DEGs", "row_count": 2, "column_count": 3}, "table": {"label": "Table 4", "caption": "The co-expression DEGs of three gene expression profiles.", "rows": [["", "Up-regulated DEGs", "Down-regulated DEGs"], ["co-expression DEGs", "CADM1, DNM1P46", "IGFBP4, PTX3, SERPINE1, COL8A1, AOX1, MAOA, ANGPTL4, TRNP1, PLPP3, NPR3, SRGN, SORBS2, TAGLN, LPAR1, CCL20, CAV1, ANPEP, LHFP, TFPI, ITPRIP, PYGB, RGS4, ITGA5, FKBP5, EPS8, PLIN2, CXCL5, CLCF1, FAM129B, NR2F1, FN1, CD59, TGFBR2, PRR16, LOXL3, OLAH, TBC1D2, CYGB, PDE7B"]], "row_count": 2, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[16]/table-wrap[1]#pone.0202896.t004"}}], "gaps": ["asset:data:geo:GSE33382 not downloaded", "asset:data:geo:GSE33382 licence not read", "asset:data:geo:GSE36001 not downloaded", "asset:data:geo:GSE36001 licence not read", "asset:data:geo:GSE42352 not downloaded", "asset:data:geo:GSE42352 licence not read", "asset:data:geo:GSE96964 not downloaded", "asset:data:geo:GSE96964 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}, {"id": "method-3", "family": null, "specific": null, "label": "Benjamini–Hochberg false discovery rate method", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The adjust P values were utilized to reduce the false positive rate using Benjamini and Hochberg false discovery rate method by default [14]."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE96964", "GSE42352", "GSE33382", "GSE36001"], "resolved_accessions": ["GSE96964", "GSE42352", "GSE33382", "GSE36001"], "statements": ["Our data are all contained within the paper."], "basis": "The paper names GSE96964, GSE42352, GSE33382, GSE36001 in Gene Expression Omnibus (GEO) database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:30153287", "data:geo:GSE33382", "asset:table:pmid:30153287:1", "asset:table:pmid:30153287:2", "asset:table:pmid:30153287:3", "asset:table:pmid:30153287:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE33382"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:12:12Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 37328, "completion_tokens": 2196, "cached_tokens": 648}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:30153287", "type": "paper", "label": "pmid:30153287"}, {"id": "source:pmid:30153287", "type": "manuscript", "label": "PMID 30153287 full text"}, {"id": "data:geo:GSE33382", "type": "dataset", "label": "GEO GSE33382"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:30153287", "type": "paper", "label": "pmid:30153287"}, {"id": "source:pmid:30153287", "type": "manuscript", "label": "PMID 30153287 full text"}, {"id": "data:geo:GSE33382", "type": "dataset", "label": "GEO GSE33382"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-30153287", "type": "extraction", "used": ["source:pmid:30153287"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE33382", "type": "accession_resolution", "used": ["data:geo:GSE33382"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:30153287", "parent_hash": "sha256:10a0bb5b3e4d6a8b6a1130f211723abb19d95dbf19811d01caf0f53666c4cda5", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE33382 licence not read", "asset:data:geo:GSE33382 not downloaded", "asset:data:geo:GSE36001 licence not read", "asset:data:geo:GSE36001 not downloaded", "asset:data:geo:GSE42352 licence not read", "asset:data:geo:GSE42352 not downloaded", "asset:data:geo:GSE96964 licence not read", "asset:data:geo:GSE96964 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["nteraction (PPI) network analysis. Real-time qPCR validation and RNA interference were conduct"], "order_basis": "paper_text_order:902", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["American Type Culture Collection (ATCC). All cell lines were cultured in DMEM (Dulbecco minimum essential medium;", "lture Collection (ATCC). All cell lines were cultured in DMEM (Dulbecco minimum essential medium; Gib", "tion The human osteosarcoma cell lines MG63, U2OS, 143B, HOS and the human osteoblast cell lin"], "order_basis": "paper_text_order:3623", "id": "assay:2"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}