High expression of KITLG is a new hallmark activating the MAPK pathway in type A and AB thymoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32463597", "kind": "science-record", "revision": 9, "content_hash": "sha256:27229e20f61a597f1f682e1e5353f60cbfee7bf4ec605dd1e524d10802031a8d", "created_at": "2026-11-01T15:41:02Z", "updated_at": "2026-11-01T22:44:54Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "High expression of KITLG is a new hallmark activating the MAPK pathway in type A and AB thymoma.", "doi": "10.1111/1759-7714.13486", "pmid": "32463597", "authors": ["Zhaoyu Yang", "Shinan Liu", "Yuanguo Wang", "Yuan Chen", "Peng Zhang", "Yimei Liu", "Hui Zhang", "Peng Zhang", "Ziyou Tao", "Kai Xiong"], "journal": "Thoracic cancer", "year": 2020, "abstract": "BACKGROUND: KIT proto-oncogene ligand (KITLG) is a pleiotropic factor which is found in diverse cancers and is involved in cell proliferation, differentiation, and survival. However, the value of KITLG in thymoma remains unclear.\nMETHODS: A total of 121 thymoma samples from The Cancer Genome Atlas Thymoma (TCGA-THYM) dataset were used to analyze KITLG related genome-wide expression profiles, and microRNA profiles and methylation alterations and a GEO dataset-GSE29695, including 37 samples was used as verification. For cell-based studies, specific small interfering RNA targeting KITLG or a KITLG overexpression vector were used to clarify the changes of the MAPK pathway in an AB thymoma cell line Thy0517.\nRESULTS: Both datasets showed that high expression of KITLG was significantly associated with type A and AB thymoma. Through multiomic analysis of the TCGA-THYM, it was found that with the high expression of KITLG, there were 220 upregulated and 72 downregulated genes at the mRNA level, 79 positive and 78 negative miRNAs, 28 hypermethylation and 163 hypomethylation regions. In the thymoma cell line Thy0517, it was found that the expression of GRB2 and the phosphorylation levels of BRAF, MEK1/2, and ERK1/2 in the MAPK pathway were positively correlated with the change in KITLG.\nCONCLUSIONS: High expression of KITLG is a new hallmark of WHO type A and AB thymomas in which it might play a critical role through the activation of the MAPK signaling pathway. Additionally, it is hoped that KITLG will become a potential target for the diagnosis of type A and AB thymoma through further research in the future.\nKEY POINTS: SIGNIFICANT FINDINGS OF THE STUDY: KIT proto-oncogene ligand (KITLG) is a new hallmark of type A and AB thymomas which induce a series of aberrant alteration of mRNA, miRNA and DNA methylation. The expression of KITLG is significantly higher in type A and AB than other subtypes of thymoma.\nWHAT THIS STUDY ADDS: KITLG activated the MAPK signaling pathway to promote type A and AB thymoma which might be a potential diagnostic biomarker or target.", "claims": [{"id": "claim-method", "statement": "Student's t‐test and multiple hypothesis correction were used to identify genome‐wide differences in gene, miRNA, and methylation profiles between the KITLGhigh and KITLGlow groups. All analyses were performed using the R limma software package.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32463597", "locator": "sections[10] \"Statistical analysis\" paragraph 2", "quote": "Student's t‐test and multiple hypothesis correction were used to identify genome‐wide differences in gene, miRNA, and methylation profiles between the KITLGhigh and KITLGlow groups. All analyses were performed using the R limma software package."}], "state": "complete"}, {"id": "claim-data-access", "statement": "We obtained RNA‐seq gene expression version 2 (RNA Seq V2) level 3 data (Data Release 9.0, Release Date: October 24, 2017) from post‐surgery thymoma tissue samples from thymoma patients of each WHO type from the UCSC XENA website (http://xena.ucsc.edu/public). We performed the analysis of RNA‐seq data of 121 thymoma samples.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32463597", "locator": "sections[3] \"Samples and genomics profile datasets\" paragraph 2", "quote": "We obtained RNA‐seq gene expression version 2 (RNA Seq V2) level 3 data (Data Release 9.0, Release Date: October 24, 2017) from post‐surgery thymoma tissue samples from thymoma patients of each WHO type from the UCSC XENA website (http://xena.ucsc.edu/public). We performed the analysis of RNA‐seq data of 121 thymoma samples."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32463597"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE29695"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE29695"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32463597", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1111/1759-7714.13486", "sha256": "sha256:eda5a7e49b0519320d10f539fc51027a9358d1067b0f97bb917a7bc4d74ae4d8", "bytes": 27688, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1111/1759-7714.13486", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7327682", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE29695", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE29695", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE29695", "version": null, "note": "We obtained RNA‐seq gene expression version 2 (RNA Seq V2) level 3 data (Data Release 9.0, Release Date: October 24, 2017) from post‐surgery thymoma tissue samples from thymoma patients of each WHO type from the UCSC XENA website (http://xena.ucsc.edu/public). We performed the analysis of RNA‐seq data of 121 thymoma samples.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "We obtained RNA‐seq gene expression version 2 (RNA Seq V2) level 3 data (Data Release 9.0, Release Date: October 24, 2017) from post‐surgery thymoma tissue samples from thymoma patients of each WHO type from the UCSC XENA website (http://xena.ucsc.edu/public). We performed the analysis of RNA‐seq data of 121 thymoma samples.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM736670", "GSM736671", "GSM736672", "GSM736673", "GSM736674", "GSM736675", "GSM736676", "GSM736677", "GSM736678", "GSM736679", "GSM736680", "GSM736681", "GSM736682", "GSM736683", "GSM736684", "GSM736685", "GSM736686", "GSM736687", "GSM736688", "GSM736689", "GSM736690", "GSM736691", "GSM736692", "GSM736693", "GSM736694", "GSM736695", "GSM736696", "GSM736697", "GSM736698", "GSM736699", "GSM736700", "GSM736701", "GSM736702", "GSM736703", "GSM736704", "GSM736705", "GSM736706", "GSM736707", "GSM736708", "GSM736709", "GSM736710"], "sample_count": 41, "group_sizes": null, "group_sizes_basis": null, "platform": "8432", "taxon": "Homo sapiens", "title": "Gene Expression Analysis of Thymic Neoplasms", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32463597:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:329782353813830b04fca99fc8d0cccef24de7d0b3cb56d886fe418c1c647e2b", "bytes": 1202, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#tca13486-tbl-0001", "version": null, "note": "Primer sequences for real‐time PCR", "structure": {"pmcid": "PMC7327682", "section_index": 8, "section_title": "RNA extraction and real‐time PCR", "row_count": 17, "column_count": 2}, "table": {"label": "Table 1", "caption": "Primer sequences for real‐time PCR", "rows": [["Primers", "Sequences"], ["KITLG ‐ Forward", "5′‐ AGCCTTATACTGGAAGAAGAGAC ‐ 3′"], ["KITLG ‐ Reverse", "5′‐ GTTGATACAAGCCACAATTACAC ‐ 3′"], ["GRB2 ‐ Forward", "5′‐ TTCTCCCTCTCTGTCAAGTTTG ‐ 3′"], ["GRB2 ‐ Reverse", "5′‐ GTATGTCGGCTGCTGTGG ‐ 3′"], ["BRAF ‐ Forward", "5′‐ ATGCTGTGGTTCTTGTATCTTG ‐ 3′"], ["BRAF ‐ Reverse", "5′‐ GACTCCGCTCTCCTCTGG ‐ 3′"], ["MEK1 ‐ Forward", "5′‐ GAAGGAGATGCGGCTGAG ‐ 3′"], ["MEK1 ‐ Reverse", "5′‐ GAGGAGGCTCGTTGACTATG ‐ 3′"], ["MEK2 ‐ Forward", "5′‐ TCCTGGACTATATTGTGAACGAG ‐ 3′"], ["MEK2 ‐ Reverse", "5′‐ GTGTGGTTTGTGAGCATCTTC ‐ 3′"], ["ERK1 ‐ Forward", "5′‐ GACGGAGTATGTGGCTACG ‐ 3′"], ["ERK1 ‐ Reverse", "5′‐ CCAGGATGCCCAGAATGTG ‐ 3′"], ["ERK2 ‐ Forward", "5′‐ CCGAGTGACGAGCCCATC ‐ 3′"], ["ERK2 ‐ Reverse", "5′‐ GTCCTCTGAGCCCTTGTCC ‐ 3′"], ["GAPDH ‐ Forward", "5′‐GCTCTCTGCTCCTCCTGTTC‐ 3′"], ["GAPDH ‐ Reverse", "5′‐CGACCAAATCCGTTGACTCC‐ 3′"]], "row_count": 17, "column_count": 2, "numeric_cells": 16, "header_rows": 1, "locator": "section[8]/table-wrap[1]#tca13486-tbl-0001"}}, {"id": "asset:table:pmid:32463597:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:640f5a92b7d07854670d2760bc8d44b2aaef9f9a5c9cf9d30638426fdf059a93", "bytes": 846, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#tca13486-tbl-0002", "version": null, "note": "Primary antibodies for western blot analysis", "structure": {"pmcid": "PMC7327682", "section_index": 9, "section_title": "Western blot analysis", "row_count": 10, "column_count": 6}, "table": {"label": "Table 2", "caption": "Primary antibodies for western blot analysis", "rows": [["Antibody", "Manufacturer", "Product #", "Source", "Type", "Dilution"], ["KITLG", "Proteintech", "26 582‐1‐AP", "Rabbit", "Polyclonal", "1:800"], ["GRB2", "CST", "3239", "Rabbit", "Monoclonal", "1:1000"], ["BRAF", "Proteintech", "20 899‐1‐AP", "Rabbit", "Polyclonal", "1:800"], ["phospho‐BRAF", "CST", "2696", "Rabbit", "Polyclonal", "1:1000"], ["MEK1/2", "CST", "8727", "Rabbit", "Monoclonal", "1:1000"], ["phospho‐MEK1/2", "CST", "9154", "Rabbit", "Monoclonal", "1:1000"], ["ERK1/2", "CST", "4695", "Rabbit", "Monoclonal", "1:1000"], ["phospho‐ ERK1/2", "CST", "4370", "Rabbit", "Monoclonal", "1:2000"], ["GAPDH", "Proteintech", "60 004‐1‐Ig", "Mouse", "Monoclonal", "1:5000"]], "row_count": 10, "column_count": 6, "numeric_cells": 22, "header_rows": 1, "locator": "section[9]/table-wrap[1]#tca13486-tbl-0002"}}], "gaps": ["asset:data:geo:GSE29695 not downloaded", "asset:data:geo:GSE29695 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Student's t‐test and multiple hypothesis correction were used to identify genome‐wide differences in gene, miRNA, and methylation profiles between the KITLGhigh and KITLGlow groups. All analyses were performed using the R limma software package."}}, {"id": "method-2", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}, {"id": "method-3", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.8, "band": "high", "quote": "limma"}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE29695"], "resolved_accessions": ["GSE29695"], "statements": ["We obtained RNA‐seq gene expression version 2 (RNA Seq V2) level 3 data (Data Release 9.0, Release Date: October 24, 2017) from post‐surgery thymoma tissue samples from thymoma patients of each WHO type from the UCSC XENA website (http://xena.ucsc.edu/public). We performed the analysis of RNA‐seq data of 121 thymoma samples."], "basis": "The paper names GSE29695 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:32463597", "data:geo:GSE29695", "asset:table:pmid:32463597:1", "asset:table:pmid:32463597:2"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE29695"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:20:08Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 22398, "completion_tokens": 2246, "cached_tokens": 520}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32463597", "type": "paper", "label": "pmid:32463597"}, {"id": "source:pmid:32463597", "type": "manuscript", "label": "PMID 32463597 full text"}, {"id": "data:geo:GSE29695", "type": "dataset", "label": "GEO GSE29695"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32463597", "type": "paper", "label": "pmid:32463597"}, {"id": "source:pmid:32463597", "type": "manuscript", "label": "PMID 32463597 full text"}, {"id": "data:geo:GSE29695", "type": "dataset", "label": "GEO GSE29695"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32463597", "type": "extraction", "used": ["source:pmid:32463597"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE29695", "type": "accession_resolution", "used": ["data:geo:GSE29695"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32463597", "parent_hash": "sha256:495d936fa8c34e1b567ab2e26ac145468401df6f2ef9a066e9eee2c8fb6df8d1", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE29695 licence not read", "asset:data:geo:GSE29695 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["own the patent of this cell line. Cells were cultured in DMEM (Gibco) supplemented with 10% fetal bov"], "order_basis": "paper_text_order:3013", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["erformed using the R limma software package. qPCR and protein data were depicted as the mean ±"], "order_basis": "paper_text_order:3503", "id": "assay:2"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Student's t‐test and multiple hypothesis correction were used to identify genome‐wide differences in gene, miRNA, and methylation profiles between the KITLGhigh and KITLGlow groups. All analyses were performed using the R limma software package."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}