Glutathione metabolism is essential for self-renewal and chemoresistance of pancreatic cancer stem cells.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33312407", "kind": "science-record", "revision": 6, "content_hash": "sha256:13d41e32b53f759dc633f815331f31440a50e298f2f1d85cf8f53313d444fcd7", "created_at": "2026-11-01T15:41:19Z", "updated_at": "2026-11-01T21:24:17Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Glutathione metabolism is essential for self-renewal and chemoresistance of pancreatic cancer stem cells.", "doi": "10.4252/wjsc.v12.i11.1410", "pmid": "33312407", "authors": ["Petra Jagust", "Sonia Alcalá", "Bruno Sainz Jr", "Christopher Heeschen", "Patricia Sancho"], "journal": "World journal of stem cells", "year": 2020, "abstract": "BACKGROUND: Cellular metabolism regulates stemness in health and disease. A reduced redox state is essential for self-renewal of normal and cancer stem cells (CSCs). However, while stem cells rely on glycolysis, different CSCs, including pancreatic CSCs, favor mitochondrial metabolism as their dominant energy-producing pathway. This suggests that powerful antioxidant networks must be in place to detoxify mitochondrial reactive oxygen species (ROS) and maintain stemness in oxidative CSCs. Since glutathione metabolism is critical for normal stem cell function and CSCs from breast, liver and gastric cancer show increased glutathione content, we hypothesized that pancreatic CSCs also rely on this pathway for ROS detoxification.\nAIM: To investigate the role of glutathione metabolism in pancreatic CSCs.\nMETHODS: Primary pancreatic cancer cells of patient-derived xenografts (PDXs) were cultured in adherent or CSC-enriching sphere conditions to determine the role of glutathione metabolism in stemness. Real-time polymerase chain reaction (PCR) was used to validate RNAseq results involving glutathione metabolism genes in adherent vs spheres, as well as the expression of pluripotency-related genes following treatment. Public TCGA and GTEx RNAseq data from pancreatic cancer vs normal tissue samples were analyzed using the webserver GEPIA2. The glutathione-sensitive fluorescent probe monochlorobimane was used to determine glutathione content by fluorimetry or flow cytometry. Pharmacological inhibitors of glutathione synthesis and recycling [buthionine-sulfoximine (BSO) and 6-Aminonicotinamide (6-AN), respectively] were used to investigate the impact of glutathione depletion on CSC-enriched cultures. Staining with propidium iodide (cell cycle), Annexin-V (apoptosis) and CD133 (CSC content) were determined by flow cytometry. Self-renewal was assessed by sphere formation assay and response to gemcitabine treatment was used as a readout for chemoresistance.\nRESULTS: Analysis of our previously published RNAseq dataset E-MTAB-3808 revealed up-regulation of genes involved in the KEGG (Kyoto Encyclopedia of Genes and Genomes) Pathway Glutathione Metabolism in CSC-enriched cultures compared to their differentiated counterparts. Consistently, in pancreatic cancer patient samples the expression of most of these up-regulated genes positively correlated with a stemness signature defined by NANOG, KLF4, SOX2 and OCT4 expression (P < 10-5). Moreover, 3 of the upregulated genes (MGST1, GPX8, GCCT) were associated with reduced disease-free survival in patients [Hazard ratio (HR) 2.2-2.5; P = 0.03-0.0054], suggesting a critical role for this pathway in pancreatic cancer progression. CSC-enriched sphere cultures also showed increased expression of different glutathione metabolism-related genes, as well as enhanced glutathione content in its reduced form (GSH). Glutathione depletion with BSO induced cell cycle arrest and apoptosis in spheres, and diminished the expression of stemness genes. Moreover, treatment with either BSO or the glutathione recycling inhibitor 6-AN inhibited self-renewal and the expression of the CSC marker CD133. GSH content in spheres positively correlated with intrinsic resistance to gemcitabine treatment in different PDXs r = 0.96, P = 5.8 × 1011). Additionally, CD133+ cells accumulated GSH in response to gemcitabine, which was abrogated by BSO treatment (P < 0.05). Combined treatment with BSO and gemcitabine-induced apoptosis in CD133+ cells to levels comparable to CD133- cells and significantly diminished self-renewal (P < 0.05), suggesting that chemoresistance of CSCs is partially dependent on GSH metabolism.\nCONCLUSION: Our data suggest that pancreatic CSCs depend on glutathione metabolism. Pharmacological targeting of this pathway showed that high GSH content is essential to maintain CSC functionality in terms of self-renewal and chemoresistance.", "claims": [{"id": "claim-data-access", "statement": "RNAseq dataset E-MTAB-3808 is available at https://www.ebi.ac.uk/arrayexpress/.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33312407", "locator": "sections[33] \"Data sharing statement\" paragraph 2", "quote": "RNAseq dataset E-MTAB-3808 is available at https://www.ebi.ac.uk/arrayexpress/."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33312407"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:E-MTAB-3808"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {"hazard_ratio": "Hazard ratio was calculated using th"}, "inputs": ["data:geo:E-MTAB-3808"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33312407", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.4252/wjsc.v12.i11.1410", "sha256": "sha256:b83ff33ead4738016b79ab369c70731888887cba9f3fabb1b2e7bae266e63bb8", "bytes": 55838, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.4252/wjsc.v12.i11.1410", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7705467", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:E-MTAB-3808", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=E-MTAB-3808", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "E-MTAB-3808", "version": null, "note": "RNAseq dataset E-MTAB-3808 is available at https://www.ebi.ac.uk/arrayexpress/.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "RNAseq dataset E-MTAB-3808 is available at https://www.ebi.ac.uk/arrayexpress/.", "access_statement_kind": "data_availability_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": null, "resolution_checked_at": "2026-10-31T18:28:59Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33312407:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0ffde8107480532d8c5cee6994b7e56a442c23cef6d13103ac76fdcbc44136ab", "bytes": 1187, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#T1", "version": null, "note": "List of utilized primers", "structure": {"pmcid": "PMC7705467", "section_index": 7, "section_title": "RNA preparation and real-time polymerase chain reaction", "row_count": 37, "column_count": 2}, "table": {"label": "Table 1", "caption": "List of utilized primers", "rows": [["Gene", "Primer"], ["HPRT", ""], ["Forward", "TGACCTTGATTTATTTTGCATACC"], ["Reverse", "CGAGCAAGACGTTCAGTCCT"], ["GCLC", ""], ["Forward", "GCCGCTGAGCTGGGAGGAAA"], ["Reverse", "ATTCCACCTCATCGCCCCACT"], ["GPX1", ""], ["Forward", "TATCGAGAATGTGGCGTCCC"], ["Reverse", "GATGCCCAAACTGGTTGCAC"], ["GPX2", ""], ["Forward", "GGACATCAGGAGAACTGTCAGA"], ["Reverse", "TCAGGTAGGCGAAGACAGGA"], ["GGT1", ""], ["Forward", "CAACCTGCCCACAGTGAAGA"], ["Reverse", "TTCTTGGCCTCCATGACTGC"], ["GGT2", ""], ["Forward", "CCCTTCTTTCAGTGGGAGGG"], ["Reverse", "ATGCTGTCACCTTTGTGGCT"], ["GSTM1", ""], ["Forward", "AGGAAAAGAAGTACACGATGGG"], ["Reverse", "TTGCTCTGGGTGATCTTGTG"], ["GSTA1", ""], ["Forward", "CAACCTGCCCACAGTGAAGA"], ["Reverse", "TTCTTGGCCTCCATGACTGC"], ["GSTA2", ""], ["Forward", "CCCTTCTTTCAGTGGGAGGG"], ["Reverse", "ATGCTGTCACCTTTGTGGCT"], ["GSTA", ""], ["Forward", "TCCGTGAGATGGGTTTTAGC"], ["Reverse", "CTGTACCAACTTCATCCCGTC"], ["IDH1", ""], ["Forward", "CAAGTGACGGAACCCAAAAG"], ["Reverse", "ACCCTTAGACAGAGCCATTTG"], ["IDH2", ""], ["Forward", "ACAACACCGACGAGTCCATC"], ["Reverse", "GCCCATCGTAGGCTTTCAGT"]], "row_count": 37, "column_count": 2, "numeric_cells": 0, "header_rows": 1, "locator": "section[7]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:33312407:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b1875a216e5f94e76e99978e1ec261be33e9732f56c47d26c88805b39f5cedde", "bytes": 814, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#T2", "version": null, "note": "RNAseq reveals that glutathione metabolism genes are up-regulated in cancer stem cell-enriched cultures from pancreatic cancer patient-derived xenografts", "structure": {"pmcid": "PMC7705467", "section_index": 16, "section_title": "Connection of glutathione metabolism with stemness in human pancreatic cancer samples", "row_count": 6, "column_count": 5}, "table": {"label": "Table 2", "caption": "RNAseq reveals that glutathione metabolism genes are up-regulated in cancer stem cell-enriched cultures from pancreatic cancer patient-derived xenografts", "rows": [["PDX", "GGTs", "GSTs", "GPXs", "Synthesis and recycling"], ["PDX185", "GGT1, GGT2, GGT3P, GGT6, GGT7", "GSTA1, GSTA2, GSTT1, MGST2, MGST3", "GPX2, GPX3", "GCLC, GSR, PGD, IDH1"], ["PDX215", "GGT1, GGT2, GGT7, GGT8P", "GSTA1, GSTA4, GSTM2, GSTM4, MGST2", "", "OPLAH, IDH1"], ["PDX253", "GGT1, GGT2, GGT3P, GGT6", "GSTA1, GSTA2, GSTA4, MGST1, MGST2, MGST3", "GPX2, GPX8", "GSR, IDH1"], ["PDX354", "", "GSTA1, GSTA2, MGST1, GSTM2", "GPX3, GPX8", "GCLC, GGCT, IDH1"], ["PDX265", "", "GSTA4, GSTM1, GSTM2, GSTM4", "GPX2", "GGCT, PGD, IDH1, IDH2"]], "row_count": 6, "column_count": 5, "numeric_cells": 5, "header_rows": 1, "locator": "section[16]/table-wrap[1]#T2"}}], "gaps": ["asset:data:geo:E-MTAB-3808 not downloaded", "asset:data:geo:E-MTAB-3808 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "cox_proportional_hazards", "label": "Survival analysis", "dsl_operations": ["cox_ph"], "missing_operations": [], "expressible": true, "parameters": {"hazard_ratio": "Hazard ratio was calculated using th"}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "Cox Proportional Hazards"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["cox_ph"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: cox_proportional_hazards."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["E-MTAB-3808"], "resolved_accessions": ["E-MTAB-3808"], "statements": ["RNAseq dataset E-MTAB-3808 is available at https://www.ebi.ac.uk/arrayexpress/."], "basis": "The paper names E-MTAB-3808 in Array Express and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["cox_ph"], "assets": ["source:pmid:33312407", "data:geo:E-MTAB-3808", "asset:table:pmid:33312407:1", "asset:table:pmid:33312407:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:E-MTAB-3808"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:18:35Z", "independence": "single_reader"}, "evidence_check": {"method": "absent", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 43662, "completion_tokens": 1965, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33312407", "type": "paper", "label": "pmid:33312407"}, {"id": "source:pmid:33312407", "type": "manuscript", "label": "PMID 33312407 full text"}, {"id": "data:geo:E-MTAB-3808", "type": "dataset", "label": "GEO E-MTAB-3808"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33312407", "type": "paper", "label": "pmid:33312407"}, {"id": "source:pmid:33312407", "type": "manuscript", "label": "PMID 33312407 full text"}, {"id": "data:geo:E-MTAB-3808", "type": "dataset", "label": "GEO E-MTAB-3808"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33312407", "type": "extraction", "used": ["source:pmid:33312407"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-E-MTAB-3808", "type": "accession_resolution", "used": ["data:geo:E-MTAB-3808"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33312407", "parent_hash": "sha256:d2f604c8fb6c4f2947c9bde536263b3163c0ce62df1e91b1488ad3e88cad1f88", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:E-MTAB-3808 licence not read", "asset:data:geo:E-MTAB-3808 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "clinical_cohort", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["METHODS: Primary pancreatic cancer cells of patient-derived xenografts (PDXs) were cultured in adherent", "e flow cytometry histograms of the indicated patient-derived xenograft models; B: Correlation of genes th", "ell-enriched cultures from pancreatic cancer patient-derived xenografts We have previously demonstrated t", "n-CSCs in primary pancreatic cancer cells of patient-derived xenografts were carried out by culturing in"], "order_basis": "paper_text_order:915", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ls of patient-derived xenografts (PDXs) were cultured in adherent or CSC-enriching sphere conditions", "B-3808 comparing 5 different PDAC PDX models cultured in differentiating (adherent) or CSC-enriching"], "order_basis": "paper_text_order:953", "id": "assay:2"}, {"role": "data_generation", "definition_id": "flow_cytometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ermine glutathione content by fluorimetry or flow cytometry. Pharmacological inhibitors of glutathione s", ") and CD133 (CSC content) were determined by flow cytometry. Self-renewal was assessed by sphere formati", "tures vs adherent cultures, as determined by flow cytometry. Representative flow cytometry histograms of", "determined by flow cytometry. Representative flow cytometry histograms of the indicated patient-derived"], "order_basis": "paper_text_order:1532", "id": "assay:3"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["th propidium iodide (cell cycle), Annexin-V (apoptosis) and CD133 (CSC content) were determined by", "etion with BSO induced cell cycle arrest and apoptosis in spheres, and diminished the expression of", "d treatment with BSO and gemcitabine-induced apoptosis in CD133+ cells to levels comparable to CD13", "orobimane), cell cycle (propidium iodide) or apoptosis (Annexin-V) were determined by fluorimetry o"], "order_basis": "paper_text_order:1833", "id": "assay:4"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ression analyses were performed by RNAseq or real-time PCR. Public TCGA and GTEx RNAseq data from pancr"], "order_basis": "paper_text_order:7739", "id": "assay:5"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["cox_ph"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["Cox Proportional Hazards"], "order_basis": "consumes_earlier_output", "id": "assay:6"}]}