Death Receptor 5 (TNFRSF10B) Is Upregulated and TRAIL Resistance Is Reversed in Hypoxia and Normoxia in Colorectal Cancer Cell Lines after Treatment with Skyrin, the Active Metabolite of Hypericum spp.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33916015", "kind": "science-record", "revision": 8, "content_hash": "sha256:0cc8e80f10fc2e5782c5db948c667bcb007d76dd2c7af388ebca0e1337b798d7", "created_at": "2026-11-01T15:41:33Z", "updated_at": "2026-11-01T22:46:36Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Death Receptor 5 (TNFRSF10B) Is Upregulated and TRAIL Resistance Is Reversed in Hypoxia and Normoxia in Colorectal Cancer Cell Lines after Treatment with Skyrin, the Active Metabolite of Hypericum spp.", "doi": "10.3390/cancers13071646", "pmid": "33916015", "authors": ["Marián Babinčák", "Rastislav Jendželovský", "Ján Košuth", "Martin Majerník", "Jana Vargová", "Kamil Mikulášek", "Zbyněk Zdráhal", "Peter Fedoročko"], "journal": "Cancers", "year": 2021, "abstract": "Skyrin (SKR) is a plant bisanthraquinone secondary metabolite from the Hypericum genus with potential use in anticancer therapy. However, its effect and mechanism of action are still unknown. The negative effect of SKR on HCT 116 and HT-29 cancer cell lines in hypoxic and normoxic conditions was observed. HCT 116 cells were more responsive to SKR treatment as demonstrated by decreased metabolic activity, cellularity and accumulation of cells in the G1 phase. Moreover, an increasing number of apoptotic cells was observed after treatment with SKR. Based on the LC-MS comparative proteomic data from hypoxia and normoxia (data are available via ProteomeXchange with the identifier PXD019995), SKR significantly upregulated Death receptor 5 (DR5), which was confirmed by real-time qualitative PCR (RT-qPCR). Furthermore, multiple changes in the Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-activated cascade were observed. Moreover, the reversion of TRAIL resistance was observed in HCT 116, HT-29 and SW620 cell lines, even in hypoxia, which was linked to the upregulation of DR5. In conclusion, our results propose the use of SKR as a prospective anticancer drug, particularly as an adjuvant to TRAIL-targeting treatment to reverse TRAIL resistance in hypoxia.", "claims": [{"id": "claim-method", "statement": "Significance between samples was assessed by a one-way ANOVA with Tukey’s post-test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33916015", "locator": "sections[22] \"4.11. Statistical Analysis\" paragraph 2", "quote": "Significance between samples was assessed by a one-way ANOVA with Tukey’s post-test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Mass spectrometry data are available via ProteomeXchange with identifier PXD019995.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33916015", "locator": "sections[31] \"Data Availability Statement\" paragraph 2", "quote": "Mass spectrometry data are available via ProteomeXchange with identifier PXD019995."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33916015"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PXD019995"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PXD019995"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33916015", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3390/cancers13071646", "sha256": "sha256:16e1c096fc5de9895c9c65963c534c9107ecae88ea5a7cc094a4901d4fb80a07", "bytes": 94078, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3390/cancers13071646", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8036732", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:PXD019995", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=PXD019995", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "PXD019995", "version": null, "note": "Mass spectrometry data are available via ProteomeXchange with identifier PXD019995.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Mass spectrometry data are available via ProteomeXchange with identifier PXD019995.", "access_statement_kind": "data_availability_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": "The effect of skyrin in normoxia and hypoxia on HCT 116 cell line", "resolution_checked_at": "2026-10-31T18:35:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33916015:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ce8fc9e53d0d902f69d8b6b71a7151b7f1d857e7e65a3c034bf47158ff7456a5", "bytes": 607, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#cancers-13-01646-t001", "version": null, "note": "SKR concentration resulting in a 25% decrease of metabolic activity based on MTT assay for cancer cell lines. Values are presented as concentrations in μM with standard deviation (SD) values for all used times and conditions.", "structure": {"pmcid": "PMC8036732", "section_index": 3, "section_title": "2.1. SKR Selectively Decreases the Metabolic Activity of Cancer Cells and Their Clonogenic Ability in Hypoxia", "row_count": 3, "column_count": 5}, "table": {"label": "Table 1", "caption": "SKR concentration resulting in a 25% decrease of metabolic activity based on MTT assay for cancer cell lines. Values are presented as concentrations in μM with standard deviation (SD) values for all used times and conditions.", "rows": [["", "24 h Normoxia", "24 h Hypoxia", "48 h Normoxia", "48 h Hypoxia"], ["HCT 116", "17.88 ± 1.56", "21.96 ± 2.19", "9.50 ± 0.80", "6.70 ± 0.34"], ["HT-29", "25.67 ± 2.80", "16.45 ± 1.17", "15.83 ± 1.15", "11.36 ± 0.65"]], "row_count": 3, "column_count": 5, "numeric_cells": 14, "header_rows": 1, "locator": "section[3]/table-wrap[1]#cancers-13-01646-t001"}}, {"id": "asset:table:pmid:33916015:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ac261e50928ebaece6b2530a3d2a3dafa019eff7e2e6db45cb858c04e7baf034", "bytes": 6002, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#cancers-13-01646-t002", "version": null, "note": "List of significantly changed protein groups after SKR treatment in hypoxia (H) and normoxia (N). Log2FC is calculated between SKR-treated samples and control. Upregulation and downregulation labels: ↑ Log2FC ≥ +1.5 (upregulated); ↓ Log2FC ≤−1.5 (downregulated).", "structure": {"pmcid": "PMC8036732", "section_index": 5, "section_title": "2.3. SKR Upregulates Pathways Associated with Mitophagy and TRAIL Signalization", "row_count": 57, "column_count": 8}, "table": {"label": "Table 2", "caption": "List of significantly changed protein groups after SKR treatment in hypoxia (H) and normoxia (N). Log2FC is calculated between SKR-treated samples and control. Upregulation and downregulation labels: ↑ Log2FC ≥ +1.5 (upregulated); ↓ Log2FC ≤−1.5 (downregulated).", "rows": [["Accession", "Description of Protein Group (Gene Name)", "Log2FC (H)", "adj.p Value (H)", "Log2FC (N)", "adj.p Value (N)", "Hypoxia", "Normoxia"], ["O14763", "Tumor necrosis factor receptor superfamily member 10B (GN = TNFRSF10B)", "3.66", "0", "2.48", "0.01", "↑", "↑"], ["Q6IQ22", "Ras-related protein Rab-12 (GN = RAB12)", "2.39", "0.05", "2.33", "0.01", "↑", "↑"], ["Q9Y2H2", "Phosphatidylinositide phosphatase SAC2 (GN = INPP5F)", "3.65", "0.01", "1.05", "0.03", "↑", ""], ["P15407", "Fos-related antigen 1 (GN = FOSL1)", "1.52", "0", "2.91", "0", "↑", "↑"], ["Q9GZQ8", "Microtubule-associated proteins 1A/1B light chain 3B (GN = MAP1LC3B)", "2.54", "0", "1.78", "0", "↑", "↑"], ["Q9HBI6", "Phylloquinone omega-hydroxylase CYP4F11 (GN = CYP4F11)", "1.36", "0.04", "2.89", "0.01", "", "↑"], ["Q03405", "Urokinase plasminogen activator surface receptor (GN = PLAUR)", "1.95", "0", "2.22", "0", "↑", "↑"], ["Q7Z4Q2", "HEAT repeat-containing protein 3 (GN = HEATR3)", "2.09", "0", "1.82", "0", "↑", "↑"], ["Q53EU6", "Glycerol-3-phosphate acyltransferase 3 (GN = GPAT3)", "1.83", "0.05", "1.77", "0", "↑", "↑"], ["Q9BSH5", "Haloacid dehalogenase-like hydrolase domain-containing protein 3 (GN = HDHD3)", "3.01", "0.01", "0.44", "0.02", "↑", ""], ["P08243", "Asparagine synthetase [glutamine-hydrolyzing] (GN = ASNS)", "2.06", "0", "1.37", "0", "↑", ""], ["Q16850", "Lanosterol 14-alpha demethylase (GN = CYP51A1)", "1.84", "0", "1.33", "0", "↑", ""], ["Q9NUM4", "Transmembrane protein 106B (GN = TMEM106B)", "1.34", "0.01", "1.66", "0.01", "", "↑"], ["H3BU86", "STX16-NPEPL1 readthrough (NMD candidate) (GN = STX16-NPEPL1)", "1.8", "0.02", "1.18", "0.05", "↑", ""], ["Q8ND82", "Zinc finger protein 280C (GN = ZNF280C)", "1.86", "0", "1.06", "0.01", "↑", ""], ["Q9H6H4", "Receptor expression-enhancing protein 4 (GN = REEP4)", "1.84", "0.01", "0.98", "0.04", "↑", ""], ["Q6WCQ1", "Myosin phosphatase Rho-interacting protein (GN = MPRIP)", "0.92", "0.04", "1.78", "0", "", "↑"], ["O95352", "Ubiquitin-like modifier-activating enzyme ATG7 (GN = ATG7)", "1.56", "0.01", "1.11", "0.02", "↑", ""], ["Q8IVF2", "Protein AHNAK2 (GN = AHNAK2)", "1.93", "0.02", "0.7", "0.05", "↑", ""], ["O15231", "Zinc finger protein 185 (GN = ZNF185)", "1.51", "0", "1.09", "0.05", "↑", ""], ["Q9NQW6", "Anillin (GN = ANLN)", "0.52", "0.04", "1.84", "0", "", "↑"], ["Q9Y617", "Phosphoserine aminotransferase (GN = PSAT1)", "1.5", "0", "0.83", "0", "↑", ""], ["Q9NR12", "PDZ and LIM domain protein 7 (GN = PDLIM7)", "1.51", "0", "0.72", "0.01", "↑", ""], ["Q9NP97", "Dynein light chain roadblock-type 1 (GN = DYNLRB1)", "−1.22", "0.04", "2.37", "0", "", "↑"], ["Q8N5M9", "Protein jagunal homolog 1 (GN = JAGN1)", "−2.59", "0.01", "3.24", "0", "↓", "↑"], ["Q9NUQ3", "Gamma-taxilin (GN = TXLNG)", "−0.91", "0.02", "1.52", "0.01", "", "↑"], ["P15153", "Ras-related C3 botulinum toxin substrate 2 (GN = RAC2)", "1.57", "0.02", "−1.14", "0.01", "↑", ""], ["P14635", "G2/mitotic-specific cyclin-B1 (GN = CCNB1)", "1.86", "0", "−1.45", "0.04", "↑", ""], ["Q9H2C0", "Gigaxonin (GN = GAN)", "−2.48", "0.02", "2.43", "0.04", "↓", "↑"], ["Q9UL03", "Integrator complex subunit 6 (GN = INTS6)", "−1.77", "0", "1.5", "0", "↓", ""], ["Q14BN4", "Sarcolemmal membrane-associated protein (GN = SLMAP)", "4.26", "0.04", "−4.77", "0", "↑", "↓"], ["Q9HCS7", "Pre-mRNA-splicing factor SYF1 (GN = XAB2)", "−1.79", "0.02", "0.65", "0.04", "↓", ""], ["P31483", "Nucleolysin TIA-1 isoform p40 (GN = TIA1)", "0.65", "0.03", "−1.83", "0.02", "", "↓"], ["Q16555", "Dihydropyrimidinase-related protein 2 (GN = DPYSL2)", "−0.46", "0.03", "−1.53", "0", "", "↓"], ["P82664", "28S ribosomal protein S10, mitochondrial (GN = MRPS10)", "−1.65", "0", "−0.45", "0.03", "↓", ""], ["P55011", "Solute carrier family 12 member 2 (GN = SLC12A2)", "−1.72", "0.01", "−0.45", "0.04", "↓", ""], ["Q9H8V3", "Protein ECT2 (GN = ECT2)", "−1.83", "0.01", "−0.42", "0.04", "↓", ""], ["Q9P2R3", "Rabankyrin-5 (GN = ANKFY1)", "−1.67", "0.01", "−0.88", "0.01", "↓", ""], ["P00395", "Cytochrome c oxidase subunit 1 (GN = MT-CO1)", "−0.91", "0.03", "−1.66", "0", "", "↓"], ["Q92466", "DNA damage-binding protein 2 (GN = DDB2)", "−1.64", "0.04", "−1.15", "0.03", "↓", ""], ["Q9UHL4", "Dipeptidyl peptidase 2 (GN = DPP7)", "−1.68", "0.03", "−1.12", "0.03", "↓", ""], ["Q9BRK5", "45 kDa calcium-binding protein (GN = SDF4)", "−2.02", "0.01", "−0.81", "0", "↓", ""], ["Q6SPF0", "Atherin (GN = SAMD1)", "−1.49", "0.03", "−1.59", "0.01", "", "↓"], ["Q9NRX4", "14 kDa phosphohistidine phosphatase (GN = PHPT1)", "−1.76", "0", "−1.32", "0.01", "↓", ""], ["P14406", "Cytochrome c oxidase subunit 7A2, mitochondrial (GN = COX7A2)", "−2.14", "0", "−1.01", "0", "↓", ""], ["P35611", "Alpha-adducin (GN=ADD1)", "−1.61", "0.01", "−1.56", "0", "↓", "↓"], ["Q52LW3", "Rho GTPase-activating protein 29 (GN = ARHGAP29)", "−2.1", "0", "−1.09", "0", "↓", ""], ["Q6UX53", "Methyltransferase-like protein 7B (GN = METTL7B)", "−1.73", "0", "−1.69", "0", "↓", "↓"], ["P22830", "Ferrochelatase, mitochondrial (GN = FECH)", "−1.81", "0.01", "−1.91", "0.01", "↓", "↓"], ["O94832", "Unconventional myosin-Id (GN = MYO1D)", "−2.52", "0.01", "−1.23", "0.01", "↓", ""], ["P33552", "Cyclin-dependent kinases regulatory subunit 2 (GN = CKS2)", "−1.77", "0.01", "−2.01", "0", "↓", "↓"], ["Q92817", "Envoplakin (GN = EVPL)", "−2.76", "0.01", "−1.54", "0.01", "↓", "↓"], ["A6NJ78", "Probable methyltransferase-like protein 15 (GN = METTL15)", "−2.16", "0.02", "−3.27", "0", "↓", "↓"], ["P50748", "Kinetochore-associated protein 1 (GN = KNTC1)", "−3.94", "0", "−2.16", "0.02", "↓", "↓"], ["Q14517", "Protocadherin Fat 1 (GN = FAT1)", "−5.73", "0", "−0.49", "0.05", "↓", ""], ["P46934", "E3 ubiquitin-protein ligase NEDD4 (GN = NEDD4)", "−3.7", "0.01", "−3.94", "0", "↓", "↓"]], "row_count": 57, "column_count": 8, "numeric_cells": 296, "header_rows": 1, "locator": "section[5]/table-wrap[1]#cancers-13-01646-t002"}}, {"id": "asset:table:pmid:33916015:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:01561ca392d4647cacf4a3f3e39c2ef0b199edfadeea0d4f28b2b33ac8c8f64f", "bytes": 1822, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[2]#cancers-13-01646-t003", "version": null, "note": "List of pathways significantly connected to upregulated proteins. As the input for Reactome analysis, we used a list of all protein groups that were significantly changed (adj. p value < 0.05) between control and sample in both conditions and upregulated (Log2FC > 1). Listed are 20 pathways with a higher p-value; each entity’s p-value and FDR was calculated by the Reactome engine.", "structure": {"pmcid": "PMC8036732", "section_index": 5, "section_title": "2.3. SKR Upregulates Pathways Associated with Mitophagy and TRAIL Signalization", "row_count": 20, "column_count": 5}, "table": {"label": "Table 3", "caption": "List of pathways significantly connected to upregulated proteins. As the input for Reactome analysis, we used a list of all protein groups that were significantly changed (adj. p value < 0.05) between control and sample in both conditions and upregulated (Log2FC > 1). Listed are 20 pathways with a higher p-value; each entity’s p-value and FDR was calculated by the Reactome engine.", "rows": [["Pathway Name", "Entities Found", "Entities Total", "Entities’ p-Value", "Entities’ FDR"], ["Rab regulation of trafficking", "2", "123", "0.00236", "0.0398"], ["Attachment of GPI anchor to uPAR", "1", "7", "0.00429", "0.0398"], ["TRAIL signaling", "1", "8", "0.0049", "0.0398"], ["Regulation by c-FLIP", "1", "11", "0.00674", "0.0398"], ["Dimerization of procaspase-8", "1", "11", "0.00674", "0.0398"], ["Receptor-mediated mitophagy", "1", "11", "0.00674", "0.0398"], ["Pexophagy", "1", "11", "0.00674", "0.0398"], ["TP53 regulates transcription of death receptors and ligands", "1", "12", "0.00735", "0.0398"], ["Dissolution of Fibrin Clot", "1", "13", "0.00796", "0.0398"], ["CASP8 activity is inhibited", "1", "14", "0.00857", "0.0421"], ["Caspase activation via death receptors in the presence of ligand", "1", "19", "0.0116", "0.0421"], ["Regulation of necroptotic cell death", "1", "21", "0.0128", "0.0421"], ["Pink/Parkin mediated mitophagy", "1", "22", "0.0134", "0.0421"], ["RIPK1-mediated regulated necrosis", "1", "23", "0.014", "0.0421"], ["Regulated necrosis", "1", "23", "0.014", "0.0421"], ["Mitophagy", "1", "29", "0.0177", "0.0474"], ["Caspase activation via extrinsic apoptotic signaling pathway", "1", "29", "0.0177", "0.0474"], ["Synthesis of PA", "1", "39", "0.0237", "0.0474"], ["NGF-stimulated transcription", "1", "39", "0.0237", "0.0474"]], "row_count": 20, "column_count": 5, "numeric_cells": 78, "header_rows": 1, "locator": "section[5]/table-wrap[2]#cancers-13-01646-t003"}}, {"id": "asset:table:pmid:33916015:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:026b9ef19d7b669434abb4ec52047e1d9464206840ec2623d9898e191851adec", "bytes": 1387, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[3]#cancers-13-01646-t004", "version": null, "note": "List of pathways significantly connected to downregulated proteins. As an input for Reactome analysis, we used a list of all protein groups that were significantly changed (adj. p value < 0.05) between the control and sample in both conditions and downregulated (Log2FC < −1). All pathways are listed; each entity’s p-value and FDR was calculated by the Reactome engine.", "structure": {"pmcid": "PMC8036732", "section_index": 5, "section_title": "2.3. SKR Upregulates Pathways Associated with Mitophagy and TRAIL Signalization", "row_count": 13, "column_count": 5}, "table": {"label": "Table 4", "caption": "List of pathways significantly connected to downregulated proteins. As an input for Reactome analysis, we used a list of all protein groups that were significantly changed (adj. p value < 0.05) between the control and sample in both conditions and downregulated (Log2FC < −1). All pathways are listed; each entity’s p-value and FDR was calculated by the Reactome engine.", "rows": [["Pathway Name", "Entities Found", "Entities Total", "Entities’ p-Value", "Entities’ FDR"], ["Regulation of PTEN localization", "1", "9", "0.0063", "0.126"], ["Downregulation of ERBB4 signaling", "1", "11", "0.0077", "0.126"], ["Caspase-mediated cleavage of cytoskeletal proteins", "1", "12", "0.00839", "0.126"], ["Heme biosynthesis", "1", "15", "0.0105", "0.126"], ["Miscellaneous transport and binding events", "1", "26", "0.0181", "0.126"], ["Metabolism of porphyrins", "1", "28", "0.0195", "0.126"], ["Apoptotic cleavage of cellular proteins", "1", "38", "0.0264", "0.126"], ["XBP1(S) activates chaperone genes", "1", "48", "0.0332", "0.126"], ["IRE1alpha activates chaperones", "1", "50", "0.0346", "0.126"], ["Apoptotic execution phase", "1", "52", "0.0359", "0.126"], ["Signaling by ERBB4", "1", "62", "0.0427", "0.126"], ["Regulation of PTEN stability and activity", "1", "69", "0.0474", "0.126"]], "row_count": 13, "column_count": 5, "numeric_cells": 48, "header_rows": 1, "locator": "section[5]/table-wrap[3]#cancers-13-01646-t004"}}, {"id": "asset:table:pmid:33916015:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:625a3e40de65945fa847fd2decf80e0886218750897d1201de061ca0bda837fc", "bytes": 1511, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[1]#cancers-13-01646-t005", "version": null, "note": "Sequences of used RT-qPCR primers. Annealing Temperatures (Ta) and Product Lenghts are in table.", "structure": {"pmcid": "PMC8036732", "section_index": 21, "section_title": "4.10. RT-qPCR Analysis", "row_count": 19, "column_count": 5}, "table": {"label": "Table 5", "caption": "Sequences of used RT-qPCR primers. Annealing Temperatures (Ta) and Product Lenghts are in table.", "rows": [["Gene (NCBI Gene ID)", "GenBank Ref.seq", "Primer Name", "Sequence", "Ta and Product Length"], ["TNFRSF10B", "NM_003842", "DR5_for", "GTGATTCAGGTGAAGTGGAGC", "60 ∘C"], ["(8795)", "NM_147187", "DR5_rev", "CGACCTTGACCATCCCTCTG", "147 bp"], ["TNFRSF10B", "NM_003842", "DR5.v1_for", "ACTCCTGCCTCTCCCTGTTC", "60 ∘C"], ["(8795)", "DR5.v1_rev", "AGGTCGTTGTGAGCTTCTGTC", "186 bp"], ["TNFRSF10B", "NM_147187", "DR5.v2_for", "CTAAGTCCCTGCACCACGAC", "60 ∘C"], ["(8795)", "DR5.v2_rev", "TGACTCCTATGATGATGCCTGATT", "193 bp"], ["TNFRSF10A", "NM_003844", "DR4_for", "GTTGGTGGCTGTGCTGATTG", "60 ∘C"], ["(8797)", "DR4_rev", "TGCGTTGCTCAGAATCTCGT", "151 bp"], ["TNF (TNF alpha)", "NM_000594", "TNFa_for", "TGTCCACACGATCCCAACAC", "60 ∘C"], ["(7124)", "TNFa_rev", "GGCTGTCACACCCACAATCA", "152 bp"], ["TNFRSF1A", "NM_001065", "TNFRSF1A_for", "CGTGATCTCTATGCCCGAGT", "60 ∘C"], ["(7132)", "TNFRSF1A_rev", "GACCAGTCCAATAACCCCTGA", "244 bp"], ["TNFRSF1B", "NM_001066", "TNFRSF1B_for", "TGTCCACACGATCCCAACAC", "60 ∘C"], ["(7133)", "TNFRSF1B_rev", "GGCTGTCACACCCACAATCA", "152 bp"], ["TNFRSF6B", "NM_003823", "DcR3_for", "CTCTTCCTCCCATGACACCCT", "60 ∘C"], ["(8771)", "DcR3_rev", "ATGGAGATGTCCTGGAAAGCC", "123 bp"], ["PMM1", "NM_002676", "PMM1_for", "GCTCGCCAGAAAATTGACCCT", "61 ∘C"], ["(5372)", "PMM1_rev", "ATACTGCACCGTCCCGTTCT", "177 bp"]], "row_count": 19, "column_count": 5, "numeric_cells": 41, "header_rows": 1, "locator": "section[21]/table-wrap[1]#cancers-13-01646-t005"}}, {"id": "asset:table:pmid:33916015:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9d46f733857ba9f320929ffb337137379f2609940081484ce35d5dac884ddfda", "bytes": 911, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[25]/table-wrap[1]#array1", "version": null, "note": null, "structure": {"pmcid": "PMC8036732", "section_index": 25, "section_title": "Abbreviations", "row_count": 17, "column_count": 2}, "table": {"label": null, "caption": null, "rows": [["ABCG2", "ATP-binding cassette super-family G member 2"], ["DMSO", "Dimethylsulfoxid"], ["DR5", "Death receptor 5; known as TNFRSF10B (Tumor necrosis factor receptor superfamily 10B)"], ["DTT", "Dithiothreitol"], ["FACS", "Fluorescence-activated cell sorting"], ["FDR", "False discovery rate"], ["GN", "gene name"], ["IC50", "Half maximal inhibitory concentration"], ["LC-MS", "Liquid chromatography–mass spectrometry"], ["MTT", "3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide"], ["PBS", "Phosphate-buffered saline"], ["PTEN", "Phosphatase and tensin homolog"], ["RT-qPCR", "Reverse transcription quantitative polymerase chain reaction"], ["SDS", "Sodium dodecyl sulfate"], ["SKR", "Skyrin"], ["TNF", "Tumor necrosis factor"], ["TRAIL", "TNF-related apoptosis-inducing ligand"]], "row_count": 17, "column_count": 2, "numeric_cells": 4, "header_rows": 0, "locator": "section[25]/table-wrap[1]#array1"}}], "gaps": ["asset:data:geo:PXD019995 not downloaded", "asset:data:geo:PXD019995 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Significance between samples was assessed by a one-way ANOVA with Tukey’s post-test."}}, {"id": "method-2", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.8, "band": "high", "quote": "LIMMA"}}, {"id": "method-3", "family": "flow_cytometry_analysis", "specific": "gating", "label": "Flow cytometry analysis", "dsl_operations": ["gate_population", "quantify_mfi", "compensation_matrix"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["event_table"], "evidence": {"score": 0.8, "band": "high", "quote": "gating strategies"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["PXD019995"], "resolved_accessions": ["PXD019995"], "statements": ["Mass spectrometry data are available via ProteomeXchange with identifier PXD019995."], "basis": "The paper names PXD019995 in ProteomeXchange Consortium via the PRIDE partner repository and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:33916015", "data:geo:PXD019995", "asset:table:pmid:33916015:1", "asset:table:pmid:33916015:2", "asset:table:pmid:33916015:3", "asset:table:pmid:33916015:4", "asset:table:pmid:33916015:5", "asset:table:pmid:33916015:6"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:PXD019995"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:29:30Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 78025, "completion_tokens": 1238, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33916015", "type": "paper", "label": "pmid:33916015"}, {"id": "source:pmid:33916015", "type": "manuscript", "label": "PMID 33916015 full text"}, {"id": "data:geo:PXD019995", "type": "dataset", "label": "GEO PXD019995"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33916015", "type": "paper", "label": "pmid:33916015"}, {"id": "source:pmid:33916015", "type": "manuscript", "label": "PMID 33916015 full text"}, {"id": "data:geo:PXD019995", "type": "dataset", "label": "GEO PXD019995"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33916015", "type": "extraction", "used": ["source:pmid:33916015"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-PXD019995", "type": "accession_resolution", "used": ["data:geo:PXD019995"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33916015", "parent_hash": "sha256:dcaa72518ff56df76b2145ea1aa26debf35b0b9726e5755a0af9771b7a8ec5a2", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:PXD019995 licence not read", "asset:data:geo:PXD019995 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "mass_spectrometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ent with SKR. Based on the LC-MS comparative proteomic data from hypoxia and normoxia (data are ava", "** p < 0.01, *** p < 0.001. For comparative proteomics, the LIMMA test and the Benjamini Hochberg m", "equent analysis. All experiments (except the mass spectrometry analysis, RT-qPCR analysis and phosphatidyls"], "order_basis": "paper_text_order:740", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["was confirmed by real-time qualitative PCR (RT-qPCR). Furthermore, multiple changes in the Tumor", "s confirmed by real-time qualitative PCR (RT-qPCR). Furthermore, multiple changes in the Tumor", "ents (except the mass spectrometry analysis, RT-qPCR analysis and phosphatidylserine externalizat", "R5—both isoforms) gene fragment amplified in RT-qPCR by oligonucleotide primers DR5_for and DR5_r"], "order_basis": "paper_text_order:958", "id": "assay:2"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["changes in the Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-activated cascade we", "The effect of SKR on proportions of cells in apoptosis, secondary necrosis, necrosis and live cells"], "order_basis": "paper_text_order:1034", "id": "assay:3"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["kville, MD, USA). HT-29 and SW620 cells were cultured in complete RPMI-1640 medium (Sigma-Aldrich, St"], "order_basis": "paper_text_order:1654", "id": "assay:4"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Significance between samples was assessed by a one-way ANOVA with Tukey’s post-test."], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}