Analysis of mRNA Expression and DNA Methylation Datasets According to the Genomic Distribution of CpG Sites in Osteoarthritis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33936160", "kind": "science-record", "revision": 8, "content_hash": "sha256:ec392c0ac549142c0d7c7f3ae6538a735921f99a322403b20747daa22529422b", "created_at": "2026-11-01T15:41:34Z", "updated_at": "2026-11-01T22:03:40Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Analysis of mRNA Expression and DNA Methylation Datasets According to the Genomic Distribution of CpG Sites in Osteoarthritis.", "doi": "10.3389/fgene.2021.618803", "pmid": "33936160", "authors": ["Peng Yi", "Xiongfeng Xu", "Jiawei Yao", "Bo Qiu"], "journal": "Frontiers in genetics", "year": 2021, "abstract": "Objectives Transcriptional changes in cartilage can impact function by causing degradation such as that which occurs during the development of osteoarthritis (OA). Epigenetic regulation may be a key factor leading to transcriptional changes in OA. In this study, we performed a combined analysis of DNA methylation and gene expression microarray datasets and identified key transcription factors (TFs) central to the regulation of gene expression in OA. Methods A DNA methylation profile dataset (GSE63106) and a gene expression profiling dataset (GSE114007) were extracted from the Gene Expression Omnibus (GEO). We used ChAMP methylation analysis and the Limma package to identify differentially methylation genes (DMGs) and differentially expressed genes (DEGs) from normal and human knee cartilage samples in OA. Function enrichment analysis of DMGs was conducted using the DAVID database. A combined analysis of DEGs and DMGs was conducted to identify key TFs in OA. We then validated the mRNA expression of selected TFs in normal and OA cartilage by RT-qPCR. Primary chondrocytes were cultured and treated with the DNA methylation inhibitor 5-Aza-2-deoxycytidine (5-Aza) for functional validation. Results We identified 2,170 differential methylation sites (DMS) containing 1005 genes and 1986 DEGs between normal human and OA cartilage. Functional analysis of DMGs revealed that focal adhesion, extracellular matrix (ECM)-receptor interactions, the PI3K-Akt signaling pathway, and the FoxO signaling pathway were involved in OA. Integrated analysis showed a subset of 17 TFs. Four TFs (ELF3, SOX11, RARA, and FOXD2) were validated. RT-qPCR results showed the mRNA expression of SOX11, RARA, and FOXD2 were consistent with the results from the mRNA expression data. However, the expression of ELF3 could not be validated. Upon 5-Aza-2'-deoxycytidine (5-Aza) treatment, the mRNA levels of ELF3 and SOX11 were down-regulated, whilst RARA was up-regulated, and FOXD2 showed no significant change in expression level. Conclusions the effect of DNA methylation on the transcriptional regulation is related to the distribution of methylated sites across the genome. Epigenetic studies on the positions of DMS in transcriptional units can inform a better understanding of the function of DNA methylation and its transcription regulation.", "claims": [{"id": "claim-method", "statement": "Data between the two groups were compared using an unpaired Student’s t-test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33936160", "locator": "sections[10] \"Statistical Analysis\" paragraph 2", "quote": "Data between the two groups were compared using an unpaired Student’s t-test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33936160", "locator": "sections[4] \"DNA Methylation Profiling and Gene Expression Data\" paragraph 2", "quote": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33936160"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE114007"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE114007"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33936160", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fgene.2021.618803", "sha256": "sha256:e7e9703786252519a9df5b03aa726fd2646aa1ce04cda83ab0ba073a33dd6ec6", "bytes": 30794, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fgene.2021.618803", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8082497", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE114007", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE114007", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE114007", "version": null, "note": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM3130531", "GSM3130532", "GSM3130533", "GSM3130534", "GSM3130535", "GSM3130536", "GSM3130537", "GSM3130538", "GSM3130539", "GSM3130540", "GSM3130541", "GSM3130542", "GSM3130543", "GSM3130544", "GSM3130545", "GSM3130546", "GSM3130547", "GSM3130548", "GSM3130549", "GSM3130550", "GSM3130551", "GSM3130552", "GSM3130553", "GSM3130554", "GSM3130555", "GSM3130556", "GSM3130557", "GSM3130558", "GSM3130559", "GSM3130560", "GSM3130561", "GSM3130562", "GSM3130563", "GSM3130564", "GSM3130565", "GSM3130566", "GSM3130567", "GSM3130568"], "sample_count": 38, "group_sizes": null, "group_sizes_basis": null, "platform": "11154;18573", "taxon": "Homo sapiens", "title": "Identification of transcription factors responsible for dysregulated networks in human osteoarthritis cartilage by global gene expression analysis", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE63106", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63106", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE63106", "version": null, "note": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1541309", "GSM1541310", "GSM1541311", "GSM1541312", "GSM1541313", "GSM1541314", "GSM1541315", "GSM1541316", "GSM1541317", "GSM1541318", "GSM1541319", "GSM1541320", "GSM1541321", "GSM1541322", "GSM1541323", "GSM1541324", "GSM1541325", "GSM1541326", "GSM1541327", "GSM1541328", "GSM1541329", "GSM1541330", "GSM1541331", "GSM1541332", "GSM1541333", "GSM1541334", "GSM1541335", "GSM1541336", "GSM1541337", "GSM1541338", "GSM1541339", "GSM1541340", "GSM1541341", "GSM1541342", "GSM1541343", "GSM1541344", "GSM1541345", "GSM1541346", "GSM1541347", "GSM1541348", "GSM1541349", "GSM1541350", "GSM1541351", "GSM1541352", "GSM1541353", "GSM1541354", "GSM1541355", "GSM1541356", "GSM1541357", "GSM1541358", "GSM1541359", "GSM1541360", "GSM1541361", "GSM1541362", "GSM1541363", "GSM1541364", "GSM1541365", "GSM1541366", "GSM1541367", "GSM1541368", "GSM1541369", "GSM1541370"], "sample_count": 62, "group_sizes": null, "group_sizes_basis": null, "platform": "13534", "taxon": "Homo sapiens", "title": "Assessing transcriptionally functional CpGs in articular cartilage", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33936160:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8766fddd7f478aa48b51cf0b899e047a7d6740c578e7f21b3ea9690a59767da9", "bytes": 542, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#T1", "version": null, "note": "Primer sequences of the genes used for RT-qPCR.", "structure": {"pmcid": "PMC8082497", "section_index": 9, "section_title": "Reverse Transcription Quantitative PCR (RT–qPCR)", "row_count": 7, "column_count": 3}, "table": {"label": "TABLE 1", "caption": "Primer sequences of the genes used for RT-qPCR.", "rows": [["", "Primer sequence (5′-3′)"], ["Target Gene", "Forward", "Reverse"], ["GAPDH", "CAATGACCCCTTCATTGACC", "GACAAGCTTCCCGTTCTCAG"], ["ELF3", "GATCTCCGAGCAAGAGCGTAG", "GTCTTCGACCAGAACTGGGG"], ["FOXD2", "GCGCCAAAGCCTTCTACG", "GAGCGATAGAGCCCGCTTAG"], ["RARA", "CACACACCTGAGCAGCATCAC", "CGGTCCTTTGGTCAAGCAGT"], ["SOX11", "AGCGGAGGAGGTTTTCAGTG", "TTCCATTCGGTCTCGCCAAA"]], "row_count": 7, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[9]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:33936160:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b608321028f82a3f4da1caeedb0541fc52be606f0d8f8df424dca152c6aab0b8", "bytes": 800, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#T2", "version": null, "note": "DMS and Array sites (after filtering) in different genomic regions.", "structure": {"pmcid": "PMC8082497", "section_index": 15, "section_title": "Statistical Analysis of CpG Sites", "row_count": 14, "column_count": 5}, "table": {"label": "TABLE 2", "caption": "DMS and Array sites (after filtering) in different genomic regions.", "rows": [["Genomic regions", "DMS", "DMS rate", "Array sites (after filtering)", "Array Rate (after filtering)"], ["3’UTR", "83", "4%", "15005", "4%"], ["5’UTR", "179", "8%", "37756", "9%"], ["1stExon", "23", "1%", "19832", "5%"], ["Gene Body", "886", "41%", "139677", "34%"], ["TSS200", "52", "2%", "46675", "11%"], ["TSS1500", "132", "6%", "60212", "14%"], ["IGR", "815", "38%", "94216", "23%"], ["island", "125", "6%", "132924", "32%"], ["opensea", "1420", "65%", "144283", "35%"], ["shelf", "242", "11%", "38337", "9%"], ["shore", "383", "18%", "97829", "24%"], ["Enhancer", "1189", "55%", "94497", "23%"], ["No enhancer", "981", "45%", "318876", "77%"]], "row_count": 14, "column_count": 5, "numeric_cells": 57, "header_rows": 1, "locator": "section[15]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:33936160:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:cfbc8b473979000e5fe1f544f0f299a3fa787576b2507d82033e64c08bb1e3a7", "bytes": 1568, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#T3", "version": null, "note": "DETFs harboring DMS in knee articular cartilage from normal and OA patients.", "structure": {"pmcid": "PMC8082497", "section_index": 16, "section_title": "Integrative Analysis of DNA Methylation and Gene Expression", "row_count": 18, "column_count": 6}, "table": {"label": "TABLE 3", "caption": "DETFs harboring DMS in knee articular cartilage from normal and OA patients.", "rows": [["Methylation Status in OA", "TFs", "Gene expression status in OA", "Genomic regions", "logFC of GSE63106", "logFC of GSE114007"], ["Hyper-methylated", "SOX11", "Upregulated", "3’UTR", "0.114052191", "3.830859342"], ["", "ATOH8", "Downregulated", "Body", "0.156007596", "−2.082568147"], ["", "MSX2", "Upregulated", "TSS1500", "0.134644281", "1.303540248"], ["", "PITX1", "Downregulated", "3’UTR, Body", "0.154268857", "−1.638461524"], ["", "RARA", "Downregulated", "1stExon", "0.106699436", "−2.309531101"], ["", "PRDM16", "Downregulated", "Body", "0.162060676", "−1.769999863"], ["", "ELF3", "Downregulated", "TSS200", "0.111024436", "−3.022557431"], ["", "FOXD2", "Downregulated", "1stExon,3’UTR", "0.109470333", "−1.184733905"], ["", "TBX4", "Downregulated", "TSS200,TSS1500, Body", "0.15388695", "−1.554387492"], ["Hypo-methylated", "LEF1", "Upregulated", "Body", "−0.100907626", "2.020807828"], ["", "PPARG", "Upregulated", "Body", "−0.129022244", "1.599195067"], ["", "RFX8", "Upregulated", "TSS1500", "−0.174751917", "3.439724382"], ["", "TBX5", "Downregulated", "Body", "−0.205976918", "−1.661135603"], ["", "ARID5B", "Downregulated", "Body", "−0.105378211", "−1.201323891"], ["", "MLXIP", "Downregulated", "Body", "−0.119453723", "−1.459126795"], ["", "NFIL3", "Downregulated", "5’UTR", "−0.193317129", "−2.892963016"], ["", "BCL6", "Downregulated", "5’UTR", "−0.131035527", "−1.530121946"]], "row_count": 18, "column_count": 6, "numeric_cells": 48, "header_rows": 1, "locator": "section[16]/table-wrap[1]#T3"}}], "gaps": ["asset:data:geo:GSE114007 not downloaded", "asset:data:geo:GSE114007 licence not read", "asset:data:geo:GSE63106 not downloaded", "asset:data:geo:GSE63106 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.7, "band": "medium", "quote": "Limma"}}, {"id": "method-2", "family": "clustering", "specific": "hierarchical", "label": "Clustering", "dsl_operations": ["hierarchical_cluster"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["feature_matrix"], "evidence": {"score": 0.8, "band": "high", "quote": "hierarchical clustering"}}, {"id": "method-3", "family": null, "specific": null, "label": "unpaired Student’s t-test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Data between the two groups were compared using an unpaired Student’s t-test."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE63106", "GSE114007"], "resolved_accessions": ["GSE63106", "GSE114007"], "statements": ["GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA."], "basis": "The paper names GSE63106, GSE114007 in NCBI Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33936160", "data:geo:GSE114007", "asset:table:pmid:33936160:1", "asset:table:pmid:33936160:2", "asset:table:pmid:33936160:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE114007"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:33:01Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 22617, "completion_tokens": 1191, "cached_tokens": 528}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33936160", "type": "paper", "label": "pmid:33936160"}, {"id": "source:pmid:33936160", "type": "manuscript", "label": "PMID 33936160 full text"}, {"id": "data:geo:GSE114007", "type": "dataset", "label": "GEO GSE114007"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33936160", "type": "paper", "label": "pmid:33936160"}, {"id": "source:pmid:33936160", "type": "manuscript", "label": "PMID 33936160 full text"}, {"id": "data:geo:GSE114007", "type": "dataset", "label": "GEO GSE114007"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33936160", "type": "extraction", "used": ["source:pmid:33936160"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE114007", "type": "accession_resolution", "used": ["data:geo:GSE114007"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33936160", "parent_hash": "sha256:3b5ce78f6bfadb595c0574dd098550a6ff06f20b83a9c1155fb50feacdfddfe2", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE114007 licence not read", "asset:data:geo:GSE114007 not downloaded", "asset:data:geo:GSE63106 licence not read", "asset:data:geo:GSE63106 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["lysis of DNA methylation and gene expression microarray datasets and identified key transcription fa"], "order_basis": "paper_text_order:417", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["f selected TFs in normal and OA cartilage by RT-qPCR. Primary chondrocytes were cultured and trea", "LF3, SOX11, RARA, and FOXD2) were validated. RT-qPCR results showed the mRNA expression of SOX11,", "elected TFs in normal and OA cartilage by RT-qPCR. Primary chondrocytes were cultured and trea", ", SOX11, RARA, and FOXD2) were validated. RT-qPCR results showed the mRNA expression of SOX11,"], "order_basis": "paper_text_order:1138", "id": "assay:2"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["Life Science and Technology Co., Ltd.) were cultured in DMEM/F12 medium (cat. no. SH30023.01; Hyclon"], "order_basis": "paper_text_order:3476", "id": "assay:3"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["Limma"], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}