Identifying the Potential Therapeutic Targets for Atopic Dermatitis Through the Immune Infiltration Analysis and Construction of a ceRNA Network.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33994801", "kind": "science-record", "revision": 6, "content_hash": "sha256:c1937f91b689d336b1b66d40b4e42c4739293d7866e4d44eef76b9b7af90b056", "created_at": "2026-11-01T15:41:35Z", "updated_at": "2026-11-01T22:03:46Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identifying the Potential Therapeutic Targets for Atopic Dermatitis Through the Immune Infiltration Analysis and Construction of a ceRNA Network.", "doi": "10.2147/CCID.S310426", "pmid": "33994801", "authors": ["Shixiong Peng", "Mengjiao Chen", "Ming Yin", "Hao Feng"], "journal": "Clinical, cosmetic and investigational dermatology", "year": 2021, "abstract": "PURPOSE: This study was meant to analyze immune infiltration and construct a ceRNA network to explore the new therapeutic targets for atopic dermatitis (AD) through bioinformatics way.\nPATIENTS AND METHODS: We downloaded the AD patients' RNA expression profile datasets (GSE63741, GSE124700) from the Gene Expression Omnibus (GEO) database, which were analyzed through the GEO2R. We explored the hub genes by the enrichment analysis and the protein-protein interaction (PPI) analysis. Moreover, we estimated immune cell types and their proportions by ImmucellAI. GSE121212 dataset validation was performed to verify the robustness of the hub genes. Then, a ceRNA network was constructed by the miRWalk, miRNet, miRDB, DIANA, TargetScan, and starbase database. Finally, gene expression analysis was performed by using RT-qPCR.\nRESULTS: In total, we detected 22 differentially expressed genes (DEGs), which contained 8 downregulated genes and 14 upregulated genes. There were 5 hub genes confirmed as key genes through PPI network analysis and the ROC curves. KEGG pathway analysis revealed that they were significantly enriched in the IL-17 signaling pathway and GO analysis showed mainly in the immune cell chemotaxis. The immune infiltration profiles were different between normal controls and AD, and each of the key genes (S100A7, S100A8, S100A9, and LCE3D) was significantly correlated with the main infiltration cell of AD. A lncRNA-miRNA-mRNA ceRNA network containing the key genes was constructed, and NEAT1 and XIST, the core of ceRNA network, were significantly overexpressing verified by RT-qPCR in AD patients.\nCONCLUSION: Altogether, the key genes and their ceRNA network provided a novel perspective to the immunomodulation of AD, which may be potential and new therapeutic targets for AD.", "claims": [{"id": "claim-method", "statement": "Two groups’ data were analyzed through the unpaired Student’s t-test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33994801", "locator": "sections[11] \"Statistical Analysis\" paragraph 2", "quote": "Two groups’ data were analyzed through the unpaired Student’s t-test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33994801", "locator": "sections[3] \"Microarray Data\" paragraph 2", "quote": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/)."}, {"asset": "source:pmid:33994801", "locator": "sections[3] \"Microarray Data\" paragraph 2", "quote": "GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33994801"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE121212"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE121212"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33994801", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.2147/CCID.S310426", "sha256": "sha256:23ebd56a837747aaad1fe43358fd56223080b5a4d6d0a8e4090e91808b1f178f", "bytes": 39214, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.2147/CCID.S310426", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8112859", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE121212", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE121212", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE121212", "version": null, "note": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM3427868", "GSM3427869", "GSM3427870", "GSM3427871", "GSM3427872", "GSM3427873", "GSM3427874", "GSM3427875", "GSM3427876", "GSM3427877", "GSM3427878", "GSM3427879", "GSM3427880", "GSM3427881", "GSM3427882", "GSM3427883", "GSM3427884", "GSM3427885", "GSM3427886", "GSM3427887", "GSM3427888", "GSM3427889", "GSM3427890", "GSM3427891", "GSM3427892", "GSM3427893", "GSM3427894", "GSM3427895", "GSM3427896", "GSM3427897", "GSM3427898", "GSM3427899", "GSM3427900", "GSM3427901", "GSM3427902", "GSM3427903", "GSM3427904", "GSM3427905", "GSM3427906", "GSM3427907", "GSM3427908", "GSM3427909", "GSM3427910", "GSM3427911", "GSM3427912", "GSM3427913", "GSM3427914", "GSM3427915", "GSM3427916", "GSM3427917", "GSM3427918", "GSM3427919", "GSM3427920", "GSM3427921", "GSM3427922", "GSM3427923", "GSM3427924", "GSM3427925", "GSM3427926", "GSM3427927", "GSM3427928", "GSM3427929", "GSM3427930", "GSM3427931", "GSM3427932", "GSM3427933", "GSM3427934", "GSM3427935", "GSM3427936", "GSM3427937", "GSM3427938", "GSM3427939", "GSM3427940", "GSM3427941", "GSM3427942", "GSM3427943", "GSM3427944", "GSM3427945", "GSM3427946", "GSM3427947", "GSM3427948", "GSM3427949", "GSM3427950", "GSM3427951", "GSM3427952", "GSM3427953", "GSM3427954", "GSM3427955", "GSM3427956", "GSM3427957", "GSM3427958", "GSM3427959", "GSM3427960", "GSM3427961", "GSM3427962", "GSM3427963", "GSM3427964", "GSM3427965", "GSM3427966", "GSM3427967", "GSM3427968", "GSM3427969", "GSM3427970", "GSM3427971", "GSM3427972", "GSM3427973", "GSM3427974", "GSM3427975", "GSM3427976", "GSM3427977", "GSM3427978", "GSM3427979", "GSM3427980", "GSM3427981", "GSM3427982", "GSM3427983", "GSM3427984", "GSM3427985", "GSM3427986", "GSM3427987", "GSM3427988", "GSM3427989", "GSM3427990", "GSM3427991", "GSM3427992", "GSM3427993", "GSM3427994", "GSM3427995", "GSM3427996", "GSM3427997", "GSM3427998", "GSM3427999", "GSM3428000", "GSM3428001", "GSM3428002", "GSM3428003", "GSM3428004", "GSM3428005", "GSM3428006", "GSM3428007", "GSM3428008", "GSM3428009", "GSM3428010", "GSM3428011", "GSM3428012", "GSM3428013", "GSM3428014"], "sample_count": 147, "group_sizes": null, "group_sizes_basis": null, "platform": "16791", "taxon": "Homo sapiens", "title": "Atopic Dermatitis, Psoriasis and healthy control RNA-seq cohort", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE124700", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE124700", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE124700", "version": null, "note": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM3543594", "GSM3543595", "GSM3543596", "GSM3543597"], "sample_count": 4, "group_sizes": null, "group_sizes_basis": null, "platform": "10558", "taxon": "Homo sapiens", "title": "Gene expression data from healthy controls and atopic dermatitis patients skin", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE63741", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63741", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE63741", "version": null, "note": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1556392", "GSM1556393", "GSM1556394", "GSM1556395", "GSM1556396", "GSM1556397", "GSM1556398", "GSM1556399", "GSM1556400", "GSM1556401", "GSM1556402", "GSM1556403", "GSM1556404", "GSM1556405", "GSM1556406", "GSM1556407", "GSM1556408", "GSM1556409", "GSM1556410", "GSM1556411", "GSM1556412", "GSM1556413", "GSM1556414", "GSM1556415", "GSM1556416", "GSM1556417", "GSM1556418", "GSM1556419", "GSM1556420", "GSM1556421", "GSM1556422", "GSM1556423", "GSM1556424", "GSM1556425", "GSM1556426", "GSM1556427", "GSM1556428", "GSM1556429", "GSM1556430", "GSM1556431", "GSM1556432", "GSM1556433", "GSM1556434", "GSM1556435", "GSM1556436", "GSM1556437", "GSM1556438", "GSM1556439", "GSM1556440", "GSM1556441", "GSM1556442", "GSM1556443", "GSM1556444", "GSM1556445", "GSM1556446", "GSM1556447", "GSM1556448", "GSM1556449", "GSM1556450", "GSM1556451", "GSM1556452", "GSM1556453", "GSM1556454", "GSM1556455", "GSM1556456", "GSM1556457", "GSM1556458", "GSM1556459", "GSM1556460", "GSM1556461", "GSM1556462", "GSM1556463", "GSM1556464", "GSM1556465", "GSM1556466", "GSM1556467", "GSM1556468", "GSM1556469", "GSM1556470", "GSM1556471", "GSM1556472", "GSM1556473", "GSM1556474", "GSM1556475", "GSM1556476", "GSM1556477", "GSM1556478", "GSM1556479", "GSM1556480", "GSM1556481", "GSM1556482", "GSM1556483", "GSM1556484", "GSM1556485", "GSM1556486", "GSM1556487", "GSM1556488", "GSM1556489", "GSM1556490", "GSM1556491", "GSM1556492", "GSM1556493", "GSM1556494", "GSM1556495", "GSM1556496", "GSM1556497", "GSM1556498", "GSM1556499", "GSM1556500", "GSM1556501", "GSM1556502", "GSM1556503", "GSM1556504", "GSM1556505", "GSM1556506", "GSM1556507", "GSM1556508", "GSM1556509", "GSM1556510", "GSM1556511", "GSM1556512", "GSM1556513", "GSM1556514", "GSM1556515", "GSM1556516", "GSM1556517", "GSM1556518", "GSM1556519", "GSM1556520", "GSM1556521", "GSM1556522", "GSM1556523", "GSM1556524", "GSM1556525", "GSM1556526", "GSM1556527", "GSM1556528", "GSM1556529", "GSM1556530", "GSM1556531", "GSM1556532", "GSM1556533", "GSM1556534", "GSM1556535", "GSM1556536", "GSM1556537", "GSM1556538", "GSM1556539", "GSM1556540", "GSM1556541"], "sample_count": 150, "group_sizes": null, "group_sizes_basis": null, "platform": "19471", "taxon": "Homo sapiens", "title": "Gene Expression Analyses of Homo sapiens Inflammatory Skin Diseases", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33994801:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7b3d2e83d59d6fb2080c3ff7ae4854b29918cb663cb0687f98d73e643963f2a7", "bytes": 417, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#t0001", "version": null, "note": "Details of the GEO AD Data", "structure": {"pmcid": "PMC8112859", "section_index": 3, "section_title": "Microarray Data", "row_count": 3, "column_count": 3}, "table": {"label": "Table 1", "caption": "Details of the GEO AD Data", "rows": [["Dataset", "Platform", "Number of Samples (AD/Control, Subjects)"], ["GSE63741", "GPL19471 PIQOR (TM) Skin 2.0 Microarray, human, antisense (591)", "150(30/30,60)"], ["GSE124700", "GPL10558 Illumina HumanHT-12 V4.0 expression beadchip", "4(2/2,6)"]], "row_count": 3, "column_count": 3, "numeric_cells": 6, "header_rows": 1, "locator": "section[3]/table-wrap[1]#t0001"}}, {"id": "asset:table:pmid:33994801:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:62402719c4f200fce39c2788cb205d7fbe903fb35fcf980583176991a15061cd", "bytes": 416, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#t0002", "version": null, "note": "The Primer Used in RT-qPCR", "structure": {"pmcid": "PMC8112859", "section_index": 10, "section_title": "The RT-qPCR Analysis", "row_count": 7, "column_count": 2}, "table": {"label": "Table 2", "caption": "The Primer Used in RT-qPCR", "rows": [["Gene", "Primer Sequence (5ʹ – 3ʹ)"], ["H-actin", "F:ACCCTGAAGTACCCCATCGAG"], ["R:AGCACAGCCTGGATAGCAAC"], ["H-NEAT1", "F:CCTGCCTTCTTGTGCGTTT"], ["R:TAGCACAACACAATGACACCCT"], ["H-XIST", "F: ACTGCCACCCATATATAAGCTA"], ["R:AGTAATCACCATTCAGTAAGCCA"]], "row_count": 7, "column_count": 2, "numeric_cells": 1, "header_rows": 1, "locator": "section[10]/table-wrap[1]#t0002"}}, {"id": "asset:table:pmid:33994801:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:94953c30a882b99d6e26543f13f5700fb5bc920a24a21853d8e5572d69511fe0", "bytes": 426, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#t0003", "version": null, "note": "The DEGs of AD", "structure": {"pmcid": "PMC8112859", "section_index": 13, "section_title": "Identification of DEGs in AD", "row_count": 4, "column_count": 2}, "table": {"label": "Table 3", "caption": "The DEGs of AD", "rows": [["Regulation", "Common DEGs of GSE63741 and GSE124700"], ["Upregulated(n=14)", "CCL18, CCL22, AKR1B10, CCL19, S100A7, LCE3D, IFI27"], ["CHI3L2, AQP3, LY6D, S100A8, RAB31, MMP12, S100A9"], ["Downregulated(n=8)", "FLG2, CST6, SERPINA12, HBB, KRT15, CCND1, LCE1B, HBA1"]], "row_count": 4, "column_count": 2, "numeric_cells": 6, "header_rows": 1, "locator": "section[13]/table-wrap[1]#t0003"}}, {"id": "asset:table:pmid:33994801:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:55ad3605d173f85a3d8dc0de63a3227e4d322be9358b0724d1747507b22baea8", "bytes": 2844, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#t0004", "version": null, "note": "The Top 10 Function and Pathway Enrichment Items of the DEGs", "structure": {"pmcid": "PMC8112859", "section_index": 14, "section_title": "Function and Pathway Enrichment Analyses of the DEGs", "row_count": 30, "column_count": 4}, "table": {"label": "Table 4", "caption": "The Top 10 Function and Pathway Enrichment Items of the DEGs", "rows": [["Category", "Description", "P value", "Genes"], ["GO BP", "GO:0008544 epidermis development", "5.45551E-08", "AQP3,CST6,KRT15,S100A7,LCE3D,LCE1B,FLG2"], ["GO BP", "GO:0071621 granulocyte chemotaxis", "5.44051E-10", "S100A7,S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0097530 granulocyte migration", "1.54858E-09", "S100A7,S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0097529 myeloid leukocyte migration", "1.64556E-08", "S100A7,S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0030595 leukocyte chemotaxis", "2.08055E-08", "S100A7,S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0060326 cell chemotaxis", "1.17284E-07", "S100A7,S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0030593 neutrophil chemotaxis", "1.53171E-08", "S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:1990266 neutrophil migration", "3.74245E-08", "S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0048247 lymphocyte chemotaxis", "1.87602E-07", "S100A7,CCL18,CCL19,CCL22"], ["GO BP", "GO:0002548 monocyte chemotaxis", "2.25311E-07", "S100A7,CCL18,CCL19,CCL22"], ["GO CC", "GO:0060205 cytoplasmic vesicle lumen", "5.6214E-06", "HBA1,HBB,S100A7,S100A8,S100A9"], ["GO CC", "GO:0031983 vesicle lumen", "5.7024E-06", "HBA1,HBB,S100A7,S100A8,S100A9"], ["GO CC", "GO:0031012 extracellular matrix", "0.000923351", "MMP12,S100A7,S100A8,S100A9"], ["GO CC", "GO:0034774 secretory granule lumen", "0.001974261", "S100A7,S100A8,S100A9"], ["GO CC", "GO:0062023 collagen-containing extracellular matrix", "0.004403432", "S100A7,S100A8,S100A9"], ["GO CC", "GO:0030139 endocytic vesicle", "0.001821123", "HBA1,HBB,RAB31"], ["GO MF", "GO:0005509 calcium ion binding", "0.000192896", "MMP12,S100A7,S100A8,S100A9,FLG2"], ["GO MF", "GO:0043177 organic acid binding", "3.1967E-05", "HBA1,HBB,S100A8,S100A9"], ["GO MF", "GO:0050786 RAGE receptor binding", "6.92211E-08", "S100A7,S100A8,S100A9"], ["GO MF", "GO:0048020 CCR chemokine receptor binding", "6.67899E-06", "CCL18,CCL19,CCL22"], ["GO MF", "GO:0008009 chemokine activity", "7.58116E-06", "CCL18,CCL19,CCL22"], ["GO MF", "GO:0042379 chemokine receptor binding", "2.22851E-05", "CCL18,CCL19,CCL22"], ["GO MF", "GO:0048306 calcium-dependent protein binding", "3.99042E-05", "S100A7,S100A8,S100A9"], ["GO MF", "GO:0016209 antioxidant activity", "4.13255E-05", "HBA1,HBB,S100A9"], ["GO MF", "GO:0005125 cytokine activity", "0.000799355", "CCL18,CCL19,CCL22"], ["GO MF", "GO:0005126 cytokine receptor binding", "0.001205692", "CCL18,CCL19,CCL22"], ["KEGG pathway", "hsa04657 IL-17 signaling pathway", "5.56373E-05", "S100A7,S100A8,S100A9"], ["KEGG pathway", "hsa04062 Chemokine signaling pathway", "0.000515188", "CCL18,CCL19,CCL22"], ["KEGG pathway", "hsa04060 Cytokine-cytokine receptor interaction", "0.002080696", "CCL18,CCL19,CCL22"]], "row_count": 30, "column_count": 4, "numeric_cells": 87, "header_rows": 1, "locator": "section[14]/table-wrap[1]#t0004"}}, {"id": "asset:table:pmid:33994801:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9776a69bd971d76d6e87034ff75f4b89148bd21d0be6f40cdb043df19d4dc749", "bytes": 549, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#t0005", "version": null, "note": "The Top 5 Hub Genes", "structure": {"pmcid": "PMC8112859", "section_index": 15, "section_title": "PPI Network and Module Analyses", "row_count": 6, "column_count": 5}, "table": {"label": "Table 5", "caption": "The Top 5 Hub Genes", "rows": [["Genes", "Description", "Degree", "MCC", "Expression Change"], ["HBB", "Hemoglobin subunit beta", "4", "4", "Downregulated"], ["LCE3D", "Late cornified envelope 3D", "3", "3", "Upregulated"], ["S100A7", "S100 calcium binding protein A7", "4", "4", "Upregulated"], ["S100A9", "S100 calcium binding protein A9", "3", "4", "Upregulated"], ["S100A8", "S100 calcium binding protein A8", "3", "4", "Upregulated"]], "row_count": 6, "column_count": 5, "numeric_cells": 17, "header_rows": 1, "locator": "section[15]/table-wrap[1]#t0005"}}, {"id": "asset:table:pmid:33994801:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f0f9eccf67d98975ad842eb97d8a91317517e40e2c3edaafda07d83144f6fa1c", "bytes": 476, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#t0006", "version": null, "note": "Results of AUCs for Hub Genes", "structure": {"pmcid": "PMC8112859", "section_index": 17, "section_title": "Data Validation of the Hub Genes", "row_count": 6, "column_count": 4}, "table": {"label": "Table 6", "caption": "Results of AUCs for Hub Genes", "rows": [["Hub Genes", "AUC", "95% Confidence Interval", "P value"], ["LCE3D", "0.9342", "0.8710 to 0.9974", "<0.0001"], ["S100A8", "0.9328", "0.8717 to 0.9938", "<0.0001"], ["S100A9", "0.9246", "0.8586 to 0.9905", "<0.0001"], ["S100A7", "0.9122", "0.8383 to 0.9861", "<0.0001"], ["HBB", "0.7956", "0.6720 to 0.9193", "0.0002"]], "row_count": 6, "column_count": 4, "numeric_cells": 19, "header_rows": 1, "locator": "section[17]/table-wrap[1]#t0006"}}, {"id": "asset:table:pmid:33994801:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:98cbc775f9c966ced0fd9d28042327e7e243c578759404a860b207ca4baa1b36", "bytes": 996, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[19]/table-wrap[1]#t0007", "version": null, "note": "The miRNAs Targeting Hub Genes", "structure": {"pmcid": "PMC8112859", "section_index": 19, "section_title": "The lncRNA-miRNA-mRNA ceRNA Network of AD", "row_count": 15, "column_count": 2}, "table": {"label": "Table 7", "caption": "The miRNAs Targeting Hub Genes", "rows": [["Genes", "The miRNAs"], ["HBB", "hsa-miR-6851-3p hsa-miR-3922-5p hsa-miR-361-3p hsa-miR-1910-3p"], ["hsa-miR-6511a-5p hsa-miR-3914 hsa-miR-33a-3p hsa-miR-5009-5p"], ["hsa-miR-6822-5p hsa-miR-4307 hsa-miR-4423-3p hsa-miR-6750-5p"], ["hsa-miR-6886-3p hsa-miR-8058"], ["LCE3D", "hsa-miR-193b-5p hsa-miR-1224-5p hsa-miR-3170 hsa-miR-4700-5p"], ["hsa-miR-4320 hsa-miR-6763-5p hsa-miR-4667-5p hsa-miR-3690"], ["hsa-miR-4471 hsa-miR-513a-5p hsa-miR-4269 hsa-miR-4314"], ["hsa-miR-6750-5p hsa-miR-6855-5p hsa-miR-4691-5p hsa-miR-6792-3p"], ["hsa-miR-5004-5p"], ["S100A7", "hsa-miR-30c-2-3p hsa-miR-1343-3p hsa-miR-6788-5p hsa-miR-6852-5p"], ["S100A8", "hsa-miR-98-5p"], ["S100A9", "hsa-miR-4701-5p hsa-miR-132-5p hsa-miR-588 hsa-miR-1204"], ["hsa-miR-3677-5p hsa-miR-940 hsa-miR-6878-3p"], ["hsa-miR-766-5p hsa-miR-92a-1-5p hsa-miR-660-3p"]], "row_count": 15, "column_count": 2, "numeric_cells": 17, "header_rows": 1, "locator": "section[19]/table-wrap[1]#t0007"}}, {"id": "asset:table:pmid:33994801:8", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7d7a84b1b4a29e650a8d0639771a79df8d759615dcec5e09bc2fa4b7fe2de4b5", "bytes": 515, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[19]/table-wrap[2]#t0008", "version": null, "note": "The ceRNA Network of AD", "structure": {"pmcid": "PMC8112859", "section_index": 19, "section_title": "The lncRNA-miRNA-mRNA ceRNA Network of AD", "row_count": 8, "column_count": 3}, "table": {"label": "Table 8", "caption": "The ceRNA Network of AD", "rows": [["mRNA", "miRNA", "lncRNA"], ["HBB", "hsa-miR-361-3p", "SNHG1, GUSBP11, MALAT1"], ["LCE3D", "hsa-miR-1224-5p", "NEAT1"], ["S100A8", "hsa-miR-98-5p", "NUTM2A-AS1, TRG-AS1, XIST, TTTY15"], ["S100A9", "hsa-miR-766-5p", "RMRP, STAG3L5P-PVRIG2P-PILRB, XIST"], ["NEAT1, LINC00894, KCNQ1OT1, NUTM2A-AS1"], ["hsa-miR-588", "XIST,NEAT1"], ["hsa-miR-132-5p", "TTN-AS1"]], "row_count": 8, "column_count": 3, "numeric_cells": 11, "header_rows": 1, "locator": "section[19]/table-wrap[2]#t0008"}}], "gaps": ["asset:data:geo:GSE121212 not downloaded", "asset:data:geo:GSE121212 licence not read", "asset:data:geo:GSE124700 not downloaded", "asset:data:geo:GSE124700 licence not read", "asset:data:geo:GSE63741 not downloaded", "asset:data:geo:GSE63741 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": null, "specific": null, "label": "unpaired Student’s t-test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Two groups’ data were analyzed through the unpaired Student’s t-test."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE63741", "GSE124700", "GSE121212"], "resolved_accessions": ["GSE63741", "GSE124700", "GSE121212"], "statements": ["The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects)."], "basis": "The paper names GSE63741, GSE124700, GSE121212 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:33994801", "data:geo:GSE121212", "asset:table:pmid:33994801:1", "asset:table:pmid:33994801:2", "asset:table:pmid:33994801:3", "asset:table:pmid:33994801:4", "asset:table:pmid:33994801:5", "asset:table:pmid:33994801:6", "asset:table:pmid:33994801:7", "asset:table:pmid:33994801:8"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE121212"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:30:03Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 32894, "completion_tokens": 891, "cached_tokens": 785}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33994801", "type": "paper", "label": "pmid:33994801"}, {"id": "source:pmid:33994801", "type": "manuscript", "label": "PMID 33994801 full text"}, {"id": "data:geo:GSE121212", "type": "dataset", "label": "GEO GSE121212"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33994801", "type": "paper", "label": "pmid:33994801"}, {"id": "source:pmid:33994801", "type": "manuscript", "label": "PMID 33994801 full text"}, {"id": "data:geo:GSE121212", "type": "dataset", "label": "GEO GSE121212"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33994801", "type": "extraction", "used": ["source:pmid:33994801"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE121212", "type": "accession_resolution", "used": ["data:geo:GSE121212"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33994801", "parent_hash": "sha256:dba05a6f8f79aaa2d83aefc86993f8448aa38f1b7a923de999e0dd122ff9042c", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:GSE121212 licence not read", "asset:data:geo:GSE121212 not downloaded", "asset:data:geo:GSE124700 licence not read", "asset:data:geo:GSE124700 not downloaded", "asset:data:geo:GSE63741 licence not read", "asset:data:geo:GSE63741 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["e expression analysis was performed by using RT-qPCR. RESULTS: In total, we detected 22 different", "ere significantly overexpressing verified by RT-qPCR in AD patients. CONCLUSION: Altogether, the", "xpression analysis was performed by using RT-qPCR. RESULTS: In total, we detected 22 different", "significantly overexpressing verified by RT-qPCR in AD patients. CONCLUSION: Altogether, the"], "order_basis": "paper_text_order:918", "id": "assay:1"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}