← All .science files
pmid:34017995
Identification of potential diagnostic and prognostic biomarkers for LUAD based on TCGA and GEO databases.
Qiangqiang Zheng · Shihui Min · Qinghua Zhou
Bioscience reports · 2021 doi:10.1042/BSR20204370
Paper
complete
Experiment
complete
Data
partial
Analysis
partial
Execution
absent
Execution evidence has not yet been added to this .science file. Explore its methods, data and open questions to plan the next step.
Record details sci_version · id · kind · revision · content_hash · schema · created_at · updated_at · generator
paper object · 10 fields
authors array · 3 items
claims array · 2 items
[0] object · 6 fields
[1] object · 6 fields
evidence array · 1 item
[0] object · 3 fields
gaps array · 0 items
experiment object · 8 fields
steps array · 3 items
[0] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[1] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[2] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
materials array · 0 items
instruments array · 0 items
reagents array · 0 items
conditions object · 0 fields
gaps array · 0 items
data object · 3 fields
assets array · 12 items
[0] object · 15 fields
structure object · 4 fields
[1] object · 15 fields
structure object · 15 fields
sample_accessions array · 12 items
[2] object · 15 fields
structure object · 15 fields
sample_accessions array · 10 items
[3] object · 15 fields
structure object · 15 fields
sample_accessions array · 14 items
[4] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 15 items
[0] array · 3 items
[1] array · 3 items
[2] array · 3 items
[3] array · 3 items
[4] array · 3 items
[5] array · 3 items
[6] array · 3 items
[7] array · 3 items
[8] array · 3 items
[9] array · 3 items
[10] array · 3 items
[11] array · 3 items
[12] array · 3 items
[13] array · 3 items
[14] array · 3 items
[5] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 3 items
[0] array · 2 items
[1] array · 2 items
[2] array · 2 items
[6] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 97 items
[0] array · 5 items
[1] array · 2 items
[2] array · 5 items
[3] array · 5 items
[4] array · 5 items
[5] array · 5 items
[6] array · 5 items
[7] array · 5 items
[8] array · 5 items
[9] array · 5 items
[10] array · 5 items
[11] array · 5 items
[12] array · 5 items
[13] array · 5 items
[14] array · 5 items
[15] array · 5 items
[16] array · 5 items
[17] array · 5 items
[18] array · 5 items
[19] array · 5 items
[20] array · 5 items
[21] array · 5 items
[22] array · 5 items
[23] array · 5 items
[24] array · 5 items
[25] array · 5 items
[26] array · 5 items
[27] array · 5 items
[28] array · 5 items
[29] array · 5 items
[30] array · 5 items
[31] array · 5 items
[32] array · 5 items
[33] array · 5 items
[34] array · 5 items
[35] array · 5 items
[36] array · 5 items
[37] array · 5 items
[38] array · 5 items
[39] array · 5 items
[40] array · 5 items
[41] array · 5 items
[42] array · 5 items
[43] array · 5 items
[44] array · 5 items
[45] array · 5 items
[46] array · 5 items
[47] array · 5 items
[48] array · 5 items
[49] array · 2 items
[50] array · 5 items
[51] array · 5 items
[52] array · 5 items
[53] array · 5 items
[54] array · 5 items
[55] array · 5 items
[56] array · 5 items
[57] array · 5 items
[58] array · 5 items
[59] array · 5 items
[60] array · 5 items
[61] array · 5 items
[62] array · 5 items
[63] array · 5 items
[64] array · 5 items
[65] array · 5 items
[66] array · 5 items
[67] array · 5 items
[68] array · 5 items
[69] array · 5 items
[70] array · 5 items
[71] array · 5 items
[72] array · 5 items
[73] array · 5 items
[74] array · 5 items
[75] array · 5 items
[76] array · 5 items
[77] array · 5 items
[78] array · 5 items
[79] array · 5 items
[80] array · 5 items
[81] array · 5 items
[82] array · 5 items
[83] array · 5 items
[84] array · 5 items
[85] array · 5 items
[86] array · 5 items
[87] array · 5 items
[88] array · 5 items
[89] array · 5 items
[90] array · 5 items
[91] array · 5 items
[92] array · 5 items
[93] array · 5 items
[94] array · 5 items
[95] array · 5 items
[96] array · 5 items
[7] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 4 items
[0] array · 3 items
[1] array · 3 items
[2] array · 3 items
[3] array · 3 items
[8] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 5 items
[0] array · 3 items
[1] array · 3 items
[2] array · 3 items
[3] array · 3 items
[4] array · 3 items
[9] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 46 items
[0] array · 5 items
[1] array · 5 items
[2] array · 5 items
[3] array · 5 items
[4] array · 5 items
[5] array · 5 items
[6] array · 5 items
[7] array · 5 items
[8] array · 5 items
[9] array · 5 items
[10] array · 5 items
[11] array · 5 items
[12] array · 5 items
[13] array · 5 items
[14] array · 5 items
[15] array · 5 items
[16] array · 5 items
[17] array · 5 items
[18] array · 5 items
[19] array · 5 items
[20] array · 5 items
[21] array · 5 items
[22] array · 5 items
[23] array · 5 items
[24] array · 5 items
[25] array · 5 items
[26] array · 5 items
[27] array · 5 items
[28] array · 5 items
[29] array · 5 items
[30] array · 5 items
[31] array · 5 items
[32] array · 5 items
[33] array · 5 items
[34] array · 5 items
[35] array · 5 items
[36] array · 5 items
[37] array · 5 items
[38] array · 5 items
[39] array · 5 items
[40] array · 5 items
[41] array · 5 items
[42] array · 5 items
[43] array · 5 items
[44] array · 5 items
[45] array · 5 items
[10] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 14 items
[0] array · 9 items
[1] array · 15 items
[2] array · 15 items
[3] array · 15 items
[4] array · 15 items
[5] array · 15 items
[6] array · 15 items
[7] array · 15 items
[8] array · 15 items
[9] array · 15 items
[10] array · 15 items
[11] array · 15 items
[12] array · 15 items
[13] array · 15 items
[11] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 7 items
[0] array · 8 items
[1] array · 8 items
[2] array · 8 items
[3] array · 8 items
[4] array · 8 items
[5] array · 8 items
[6] array · 8 items
gaps array · 6 items
analysis object · 4 fields
methods array · 4 items
[0] object · 10 fields
dsl_operations array · 3 items
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 1 item
[1] object · 10 fields
dsl_operations array · 1 item
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 1 item
[2] object · 10 fields
dsl_operations array · 3 items
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 1 item
[3] object · 10 fields
dsl_operations array · 6 items
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 1 item
targets array · 0 items
gaps array · 1 item
capability object · 3 fields
requirements array · 1 item
[0] object · 6 fields
assay_families array · 9 items
gaps array · 0 items
readiness object · 8 fields
axes object · 3 fields
method object · 5 fields
required_operations array · 3 items
missing_operations array · 0 items
capability object · 4 fields
data object · 6 fields
accessions array · 3 items
resolved_accessions array · 3 items
statements array · 1 item
can_run object · 3 fields
dsl_operations array · 3 items
assets array · 10 items
steps array · 1 item
must_build object · 5 fields
dsl_operations array · 0 items
converters array · 0 items
readers array · 0 items
capabilities array · 0 items
data_gaps array · 1 item
gaps array · 0 items
review object · 5 fields
machine_critique object · 5 fields
reader object · 5 fields
evidence_check object · 2 fields
usage object · 3 fields
stages array · 1 item
[0] object · 4 fields
gaps array · 3 items
provenance object · 7 fields
entities array · 3 items
activities array · 3 items
[0] object · 4 fields
used array · 3 items
[0] object · 3 fields
[1] object · 3 fields
[2] object · 3 fields
[1] object · 4 fields
agents array · 2 items
lineage object · 4 fields
gaps array · 11 items
assays array · 1 item
[0] object · 11 fields
required_operations array · 3 items
source_hashes object · 1 field
evidence array · 1 item
Complete file
{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34017995", "kind": "science-record", "revision": 8, "content_hash": "sha256:8cd11b76d9ac861af1f6614acbb89a8b4a3baf40fd78b9f9f9cb1d017f26f8fd", "created_at": "2026-11-01T15:41:36Z", "updated_at": "2026-11-01T22:46:44Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of potential diagnostic and prognostic biomarkers for LUAD based on TCGA and GEO databases.", "doi": "10.1042/BSR20204370", "pmid": "34017995", "authors": ["Qiangqiang Zheng", "Shihui Min", "Qinghua Zhou"], "journal": "Bioscience reports", "year": 2021, "abstract": "Accumulating evidence has demonstrated that gene alterations play a crucial role in LUAD development, progression, and prognosis. The present study aimed to identify the hub genes associated with LUAD. In the present study, we used TCGA database to screen the hub genes. Then, we validated the results by GEO datasets. Finally, we used cBioPortal, UALCAN, qRT-PCR, HPA database, TCGA database, and Kaplan-Meier plotter database to estimate the gene mutation, gene transcription, protein expression, clinical features of hub genes in patients with LUAD. A total of 5930 DEGs were screened out in TCGA database. Enrichment analysis revealed that DEGs were involved in the transcriptional misregulation in cancer, viral carcinogenesis, cAMP signaling pathway, calcium signaling pathway, and ECM-receptor interaction. The combining results of MCODE and CytoHubba showed that ADCY8, ADRB2, CALCA, GCG, GNGT1, and NPSR1 were hub genes. Then, we verified the above results by GSE118370, GSE136043, and GSE140797 datasets. Compared with normal lung tissues, the expression levels of ADCY8 and ADRB2 were lower in LUAD tissues, but the expression levels of CALCA, GCG, GNGT1, and NPSR1 were higher. In the prognosis analyses, the low expression of ADCY8 and ADRB2 and the high expression of CALCA, GCG, GNGT1, and NPSR1 were correlated with poor OS and poor PFS. The significant differences in the relationship of the expression of 6 hub genes and clinical features were observed. In conclusion, 6 hub genes will not only contribute to elucidating the pathogenesis of LUAD and may be potential therapeutic targets for LUAD.", "claims": [{"id": "claim-method", "statement": "Differential expression analysis of individual genes was carried out by edgeR Bioconductor package [14].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34017995", "locator": "sections[4] \"Identification of the aberrantly expressed genes in LUAD\" paragraph 2", "quote": "Differential expression analysis of individual genes was carried out by edgeR Bioconductor package [14]."}], "state": "complete"}, {"id": "claim-data-access", "statement": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34017995", "locator": "sections[30] \"Data Availability\" paragraph 2", "quote": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34017995"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE118370"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE118370"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34017995", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1042/BSR20204370", "sha256": "sha256:c30bb84c2ff29d30d944a6ed58866168d6dfff937407ae98b0585f9cd9f8a72d", "bytes": 51792, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1042/BSR20204370", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8182989", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE118370", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE118370", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE118370", "version": null, "note": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM3325818", "GSM3325819", "GSM3325820", "GSM3325821", "GSM3325822", "GSM3325823", "GSM3325824", "GSM3325825", "GSM3325826", "GSM3325827", "GSM3325828", "GSM3325829"], "sample_count": 12, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression data from lung adenocarcinoma tissues and paired normal lung tissues", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE136043", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE136043", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE136043", "version": null, "note": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM4040007", "GSM4040008", "GSM4040009", "GSM4040010", "GSM4040011", "GSM4040012", "GSM4040013", "GSM4040014", "GSM4040015", "GSM4040016"], "sample_count": 10, "group_sizes": null, "group_sizes_basis": null, "platform": "13497", "taxon": "Homo sapiens", "title": "mRNAs microarray from 5 fresh lung cancer tissues and 5 fresh non-tumor tissues.", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE140797", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE140797", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE140797", "version": null, "note": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM4185443", "GSM4185444", "GSM4185445", "GSM4185446", "GSM4185447", "GSM4185448", "GSM4185449", "GSM4185450", "GSM4185451", "GSM4185452", "GSM4185453", "GSM4185454", "GSM4185455", "GSM4185456"], "sample_count": 14, "group_sizes": null, "group_sizes_basis": null, "platform": "13497", "taxon": "Homo sapiens", "title": "Gene expression signatures for lung adenocarcinoma", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34017995:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:70c129995237f6eb1e2853d5df71bc610d765b75f6b302ea3fcbc34e5ddde3f3", "bytes": 795, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#T1", "version": null, "note": "The primer sequence of qRT-PCR", "structure": {"pmcid": "PMC8182989", "section_index": 12, "section_title": "RNA extraction and qRT-PCR of the hub genes", "row_count": 15, "column_count": 3}, "table": {"label": "Table 1", "caption": "The primer sequence of qRT-PCR", "rows": [["Gene", "Primer", "Sequence (5′ to 3′)"], ["ADRB2", "Forward", "TTGCTGGCACCCAATAGAAGC"], ["", "Reverse", "CAGACGCTCGAACTTGGCA"], ["ADCY8", "Forward", "CCTGCGGCACCAAAGTCTT"], ["", "Reverse", "CGAGTTGCTAGGGGCACAG"], ["CALCA", "Forward", "ATGGGCTTCCAAAAGTTCTCC"], ["", "Reverse", "GCCGATGAGTCACACAGGTG"], ["GCG", "Forward", "CTGAAGGGACCTTTACCAGTGA"], ["", "Reverse", "CCTGGCGGCAAGATTATCAAG"], ["GNGT1", "Forward", "ATTACGTTGAAGAACGATCTGGC"], ["", "Reverse", "GGATGCCCTTTACCAGTGGA"], ["NPSR1", "Forward", "ATGCCAGCCAACTTCACAGAG"], ["", "Reverse", "AAGGAGTAGTAGAAGGAACCCC"], ["GAPDH", "Forward", "GGACCTGACCTGCCGTCTAG"], ["", "Reverse", "GTAGCCCAGGATGCCCTTGA"]], "row_count": 15, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[12]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:34017995:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:3a74b836187c48a34a450c80781ae4feca8ea23032557a1be9d3ced9c76e75ed", "bytes": 5387, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[18]/table-wrap[1]#T2", "version": null, "note": "Compared with adjacent non-tumorous tissues, the top 300 up-regulated and 300 down-regulated genes in LUAD based on TCGA database", "structure": {"pmcid": "PMC8182989", "section_index": 18, "section_title": "Aberrantly expressed genes based on TCGA data in LUAD", "row_count": 3, "column_count": 2}, "table": {"label": "Table 2", "caption": "Compared with adjacent non-tumorous tissues, the top 300 up-regulated and 300 down-regulated genes in LUAD based on TCGA database", "rows": [["DEGs", "Genes"], ["Up-regulated", "TFF2, REG4, LINC00676, FGB, DEFA5, MAGEA3, ALB, MAGEA6, RNU5B-1, MAGEC1, CALCA, TFF1, MAGEA10, MAGEA4, LINC01419, FGF19, AFP, CGA, MAGEA12, PRB4, SPINK4, PITX2, TFAP2D, CASP14, PSG1, GC, BARX1, GCG, INSL4, ACTL8, PDX1, HOXC12, C11orf86, TRIM48, FGL1, CSAG1, PRAME, LINC02418, LIN28B, KRT20, CPN1, PAEP, SERPINA4, TM4SF5, DSCAM-AS1, RNU5A-1, MAGEA1, DCAF4L2, RN7SKP255, RNY1, MAGEC2, PSG4, PSG5, COX7B2, SPP2, HIST1H1B, PAGE2, REG1A, F2, AKR1B10, PSG3, CGB5, SST, SPANXB1, CALML5, DLK1, HOXB9, SSX1, PADI3, UGT1A10, AC079466.1, NKX1-2, UGT2B11, SNORA71D, RNU4-1, DLL3, HOXC13, MAGEA11, MUC17, KRTAP4-1, APOBEC1, ANXA10, FOXD3-AS1, SPAG11B, OTX2, TPSP2, VIL1, AC026785.3, LHX1, HIST1H3C, BARX1-DT, FAM83A, TRPM8, GAGE2A, CYP24A1, AL160271.1, MAGEA9B, RNY3, PSG11, RF00100, PAX7, MAGEB2, SNORA74A, SPINK1, HIST1H4L, AL136537.2, IGF2BP1AC011298.1, HOXC11, HIST1H1D, AC007128.2, VGLL2, HOTAIR, NEUROD1, SPAG11A, MAGEB1, SLCO1B3, KRT81, PCSK1, POU3F2, RNU4-2, UGT1A8, LINC01667, CYP11B1, HIST1H3B, HIST1H3F, KLK6, DSCR8, BPIFB4, RNA5-8SP2, SNORA23, KRT6A, AC079062.1, CPS1, AC090502.1, CST4, LINC00942, AL513304.1, TMPRSS11E, AC133785.1, SP3P, HOXD13, EPS8L3, SP8, SNORA73B, AF274573.1, HIST1H2AJ, ASNSP1, SCARNA5, AC005256.1, TINAG, ANKS4B, AC061975.6, DPYSL5, PASD1, PHOX2B, FOXI3, SPRR1B, MMP13, SLCO1B1, BCAR4, CT83, KCNC2, MIR548XHG, FTHL17, RN7SKP203, FAM83A-AS1, ONECUT1, LIPK, GNGT1, INHA, LIN28A, AC114786.2, EEF1A2, HIST1H2BI, LINC01234, AC133681.1, IL37, SLC18A3, AL355075.4, FAR2P1, CLDN10-AS1, TCN1, NR0B1, MAGEA4-AS1, HOXC13-AS, LHX1-DT, LINC01833, AL354685.1, HOXA13, FUT9, TUBA3C, AL139023.1, PRSS1, MYEOV, DMBX1, HIST1H4F, SNORA49, AFAP1-AS1, AC098592.1, ADGRG7, GFY, LINC01559, PADI1, HOXB13, ERVV-2, LINC00973, POU6F2-AS2, AC026336.3, CALML3, AC023824.1, FEZF1, AS1, KRT75, SLC2A2, SCARNA10, KLK12, DPPA2, TM4SF20, LINC02163, LINC01980, HIST1H2BM, HMGA2, AL121949.2, VGF, AKR1B15, LINC01194, COL11A1, CTAG2, MAGEB16, SOX14, TRIM15, CST1, INS, IL36RN, VCX3A, ETNPPL, S100A7, PAH, OLFM4, LINC01468, GAGE1, AC016044.1, BRDT, Z98257.1, HOXC10, LINC01518, IL1RAPL2, HIST1H2BB, HHIPL2, CRABP1, RN7SKP9, KISS1R, ZNF280A, AC079160.1, BAGE2, SNORA54, MIR3609, RMRP, TEX19, DUSP13, PRB1, HIST1H4C, PIWIL3, FAM230C, AC020907.1, RN7SKP227, UGT3A1, GPX2, C6orf15, DKK4, HOXD11, UCA1, G6PC, LHX5, AC106785.2, LINC01511, EIF4E1B, LINC01214, ATP10B, NPSR1, AF127577.3, PCDH8, PPY2P, KCNU1, GABRA3, AP003900.1, PPP1R14D, PSG6, PRSS2, KIF1A, DSCR4, FETUB, MUC6, FABP7, PNPLA5, SNORA80A, SALL3, SP9, AC068228.1, HIST1H3J"], ["Down-regulated", "SLC6A4, CD300LG, AGER, AL606469.1, HTR3C, FABP4, SFTPC, LINC02016, CSF3, CHRM1, MYOC, FAM107A, ANKRD1, HBA1, AC095050.1, SERTM1, OR6K3, ANGPT4, ITLN2, FCN3, GPM6A, LGI3, LINC01996, TMEM100, CA4, AC084030.1, ALAS2, AP002856.2, RPL13AP17, UPK3B, AC128709.3, AC093787.1, AC104984.1, HBB, AC008763.3, MCEMP1, WNT3A, GPD1, HBA2, SH3GL3, AC135012.3, AC009093.3, NCAPGP2, RTKN2, LINC01082, CD5L, OVCH1, C10orf67, FENDRR, FREM3, PI16, AC104984.4, CLEC4M, AL354714.1, TNR, KCNA4, GPIHBP1, CLDN18, AC010776.3, MTATP8P1, AL590226.1, GRIA1, OTC, SGCG, ANGPTL7, CLEC3B, SOSTDC1, SSTR4, ADAMTS8, CHRNA2, CHIAP2, RS1, ADAMTS7P3, ARMH2, ARC, SCUBE1, VEGFD, CLIC5, LINC00656, AC104237.2, KRT79, MIR3945HG, EDNRB, AC104237.3, LANCL1, AS1, AC026369.3, PTPRQ, AL445307.1, NCKAP5, FHL1, INMT, BTNL9, CHRM2, PRX, CACNA1S, ADRA1A, LINC00968, TNNC1, HAS1, CYP1A2, DNASE1L3, LINC00163, STXBP6, CNTN6, GP9, ADH1B, INMT-MINDY4, MYZAP, PACRG-AS3, LINC01070, SCGB1A1, AC013457.1, CAV1, CAVIN2, Z82246.1, CTXND1, DES, AL772337.2, SLC4A1, AC104257.1, LINC01081, FMO2, LINC02570, GDF10, ADCY8, AC093110.1, LINC02154, GYPE, VIPR1, SEMA3G, AC044810.2, AC091305.1, TEK, ST8SIA6, SPOCK2, RAMP3, MGAT3, DEFA3, DNASE2B, CAV3, TCF21, AGBL1, ADRB1, NECAB1, ECEL1P2, ALKAL2, MYH2, FOLR3, HELT, LINC00551, ODAM, ACADL, AL591686.1, RETN, LINC01616, RSPO1, DPP6, AL136369.1, FGF10, MARCO, PCDH15, AL161740.1, LYVE1, AC027288.3, AL359378.1, FOSB, CCDC141, PTPN5, AGRP, CMTM5, OVCH2, AC004947.1, AC113404.1, RXFP1, FGF10-AS1, LINC01863, FXYD1, AC092691.1, PARAL1, FPR2, C2orf71, AP000438.1, MT1JP, ADRB2, SEC14L3, AC053503.6, SFRP5, AC010976.2, FGFBP2, GPA33, STX11, IL1RL1, AC119424.1, AQP4, SOX7, ADGRE3, AC027288.2, SCN4B, SLC14A1, SLC19A3, ADGRG4, FAM189A2, AC096531.2, ABCA8, PPP1R17, AC005324.1, WFIKKN2, AP001189.1, COL6A6, RAMP2, RGCC, IGSF10, LRRC36, ROBO4, CD36, KANK3, CD101, AL355974.2, SIRPB1, AL109741.3, FO681492.1, S1PR1, HHIP, ACTN2, LIMS2, HID1-AS1, AC116312.1, FHL5, RBP2, CXCR1, LINC00844, TAL1, ANOS1, AC092834.1, AL354714.3, CASQ2, FOXF1, HIGD1B, HPSE2, LINC01447, TNXB, HSPA12B, TENT5B, PLAC9, MASP1, SERPINA2, SFTPA1, EDN3, C2orf91, CCDC85A, MT1M, AWAT2, SOX17, EMCN, RXFP2, PLA2G4F, LRRN3, AC093890.1, NMUR1, MAMDC2, TUBB1, MFAP4, AP003385.4, AC026992.2, LAMP3, F11, AC104211.2, CLDN5, SCARA5, CALCRL, AC105914.2, SPAAR, NAV2-AS2, PLAC9P1, AOC3, ASPA, EMP2, AC010776.2, AL138737.1, CATSPERD, EPAS1, DCC, GSG1L, MOGAT1, AC097537.1, LINC01645, PLPPR5, AC018647.1, AC134312.1, CDO1, C14orf132, TGFBR3, NPR1, CCL24, GCOM1, MGAT3-AS1, JPH4, PRKG2, CRTAC1, ARHGEF26"]], "row_count": 3, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[18]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:34017995:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c961c7bcd4e6c7180382f48750f241f664a6cf43946d39b1b3e7cf0b06361f56", "bytes": 6150, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[19]/table-wrap[1]#T3", "version": null, "note": "GO analysis and KEGG pathway analysis of the top 300 up-regulated and 300 down-regulated genes associated with LUAD", "structure": {"pmcid": "PMC8182989", "section_index": 19, "section_title": "GO function and KEGG pathway analyses for the DEGs", "row_count": 97, "column_count": 5}, "table": {"label": "Table 3", "caption": "GO analysis and KEGG pathway analysis of the top 300 up-regulated and 300 down-regulated genes associated with LUAD", "rows": [["Category", "GO ID", "Term", "Count", "P value"], ["A. Up-regulated DEGs", ""], ["BP", "GO:0006366", "Transcription from RNA polymerase II promoter", "14", "0.003"], ["BP", "GO:0007275", "Multicellular organism development", "12", "4.58E-08"], ["BP", "GO:0006334", "Nucleosome assembly", "12", "0.021"], ["BP", "GO:0044267", "Cellular protein metabolic process", "11", "4.32E-07"], ["BP", "GO:0007267", "Cell–cell signaling", "10", "0.001"], ["BP", "GO:0007399", "Nervous system development", "8", "1.98E-05"], ["BP", "GO:0031047", "Gene silencing by RNA", "8", "1.62E-04"], ["BP", "GO:0009952", "Anterior/posterior pattern specification", "8", "0.031"], ["BP", "GO:0007565", "Female pregnancy", "7", "2.90E-07"], ["BP", "GO:0045815", "Positive regulation of gene expression, epigenetic", "7", "8.51E-07"], ["BP", "GO:0045814", "Negative regulation of gene expression, epigenetic", "7", "2.09E-06"], ["BP", "GO:0051290", "Protein heterotetramerization", "7", "4.52E-06"], ["BP", "GO:0000183", "Chromatin silencing at rDNA", "7", "1.28E-05"], ["BP", "GO:0006335", "DNA replication-dependent nucleosome assembly", "7", "4.46E-05"], ["BP", "GO:0032200", "Telomere organization", "7", "3.34E-04"], ["BP", "GO:0007596", "Blood coagulation", "6", "5.01E-04"], ["BP", "GO:0001501", "Skeletal system development", "6", "0.002"], ["BP", "GO:0042593", "Glucose homeostasis", "6", "0.004"], ["BP", "GO:0008544", "Epidermis development", "6", "0.014"], ["BP", "GO:0007586", "Digestion", "6", "0.044"], ["CC", "GO:0005576", "Extracellular region", "51", "2.03E-12"], ["CC", "GO:0005615", "Extracellular space", "33", "1.32E-05"], ["CC", "GO:0000786", "Nucleosome", "13", "3.16E-10"], ["CC", "GO:0043234", "Protein complex", "11", "0.013"], ["CC", "GO:0000784", "Nuclear chromosome, telomeric region", "8", "1.37E-06"], ["CC", "GO:0000228", "Nuclear chromosome", "8", "4.73E-04"], ["CC", "GO:0000788", "Nuclear nucleosome", "7", "6.59E-06"], ["CC", "GO:0005796", "Golgi lumen", "6", "0.004"], ["CC", "GO:0045095", "Keratin filament", "5", "0.022"], ["MF", "GO:0043565", "Sequence-specific DNA binding", "19", "8.84E-06"], ["MF", "GO:0046982", "Protein heterodimerization activity", "17", "3.21E-05"], ["MF", "GO:0005509", "Calcium ion binding", "15", "0.019"], ["MF", "GO:0001077", "Transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding", "10", "8.79E-04"], ["MF", "GO:0004252", "Serine-type endopeptidase activity", "8", "5.88E-05"], ["MF", "GO:0042393", "Histone binding", "8", "3.01E-04"], ["MF", "GO:0005179", "Hormone activity", "8", "0.018"], ["MF", "GO:0008083", "Growth factor activity", "6", "0.028"], ["MF", "GO:0031492", "Nucleosomal DNA binding", "5", "0.001"], ["KEGG", "hsa05202", "Transcriptional misregulation in cancer", "14", "5.84E-09"], ["KEGG", "hsa05203", "Viral carcinogenesis", "11", "3.48E-07"], ["KEGG", "hsa05034", "Alcoholism", "6", "0.019"], ["KEGG", "hsa04950", "Maturity onset diabetes of the young", "6", "0.041"], ["KEGG", "hsa04922", "Glucagon signaling pathway", "5", "8.74E-05"], ["KEGG", "hsa04910", "Insulin signaling pathway", "5", "0.008"], ["KEGG", "hsa04911", "Insulin secretion", "5", "0.008"], ["KEGG", "hsa04970", "Salivary secretion", "5", "0.013"], ["KEGG", "hsa05322", "Systemic lupus erythematosus", "5", "0.039"], ["B. Down-regulated DEGs", ""], ["BP", "GO:0007155", "Cell adhesion", "17", "3.85E-05"], ["BP", "GO:0007166", "Cell surface receptor signaling pathway", "14", "9.13E-07"], ["BP", "GO:0001525", "Angiogenesis", "14", "8.83E-06"], ["BP", "GO:0006898", "Receptor-mediated endocytosis", "9", "5.60E-04"], ["BP", "GO:0001666", "Response to hypoxia", "9", "9.35E-04"], ["BP", "GO:0031623", "Receptor internalization", "7", "6.32E-06"], ["BP", "GO:0006935", "Chemotaxis", "6", "0.001"], ["BP", "GO:0006936", "Muscle contraction", "6", "0.006"], ["BP", "GO:0006816", "Calcium ion transport", "6", "0.010"], ["BP", "GO:0001934", "Positive regulation of protein phosphorylation", "5", "0.001"], ["BP", "GO:0045766", "Positive regulation of angiogenesis", "5", "0.003"], ["BP", "GO:0060021", "Palate development", "5", "0.005"], ["BP", "GO:0072659", "Protein localization to plasma membrane", "5", "0.009"], ["BP", "GO:0001570", "Vasculogenesis", "5", "0.036"], ["BP", "GO:0015701", "Bicarbonate transport", "5", "0.049"], ["CC", "GO:0016021", "Integral component of membrane", "86", "3.44E-06"], ["CC", "GO:0005886", "Plasma membrane", "79", "3.44E-08"], ["CC", "GO:0005576", "Extracellular region", "42", "1.29E-07"], ["CC", "GO:0070062", "Extracellular exosome", "41", "0.034"], ["CC", "GO:0005887", "Integral component of plasma membrane", "37", "9.02E-07"], ["CC", "GO:0005615", "Extracellular space", "34", "6.22E-06"], ["CC", "GO:0009986", "Cell surface", "17", "2.48E-04"], ["CC", "GO:0005578", "Proteinaceous extracellular matrix", "14", "6.55E-06"], ["CC", "GO:0016324", "Apical plasma membrane", "9", "0.002"], ["CC", "GO:0045121", "Membrane raft", "9", "0.013"], ["CC", "GO:0009897", "External side of plasma membrane", "8", "2.79E-04"], ["CC", "GO:0016323", "Basolateral plasma membrane", "8", "0.003"], ["CC", "GO:0030018", "Z disc", "8", "0.008"], ["CC", "GO:0072562", "Blood microparticle", "6", "0.012"], ["CC", "GO:0043235", "Receptor complex", "6", "0.024"], ["CC", "GO:0005581", "Collagen trimer", "5", "0.005"], ["CC", "GO:0030666", "Endocytic vesicle membrane", "5", "0.017"], ["MF", "GO:0008201", "Heparin binding", "9", "2.46E-04"], ["MF", "GO:0004872", "Receptor activity", "7", "0.025"], ["MF", "GO:0044325", "Ion channel binding", "6", "0.006"], ["KEGG", "hsa04024", "cAMP signaling pathway", "16", "8.29E-06"], ["KEGG", "hsa04022", "cGMP-PKG signaling pathway", "10", "0.002"], ["KEGG", "hsa04080", "Neuroactive ligand-receptor interaction", "9", "0.004"], ["KEGG", "hsa04512", "ECM–receptor interaction", "8", "0.001"], ["KEGG", "hsa05144", "Malaria", "8", "0.008"], ["KEGG", "hsa04924", "Renin secretion", "7", "0.014"], ["KEGG", "hsa04020", "Calcium signaling pathway", "6", "0.001"], ["KEGG", "hsa04270", "Vascular smooth muscle contraction", "6", "0.007"], ["KEGG", "hsa04923", "Regulation of lipolysis in adipocytes", "5", "0.005"], ["KEGG", "hsa05414", "Dilated cardiomyopathy", "5", "0.013"], ["KEGG", "hsa04261", "Adrenergic signaling in cardiomyocytes", "5", "0.035"], ["KEGG", "hsa04970", "Salivary secretion", "5", "0.036"]], "row_count": 97, "column_count": 5, "numeric_cells": 282, "header_rows": 1, "locator": "section[19]/table-wrap[1]#T3"}}, {"id": "asset:table:pmid:34017995:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:10409102e0e24fefe1ecf69b99b137396eb1bcd7865ccb7849eb06305ac1391e", "bytes": 500, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[1]#T4", "version": null, "note": "The Venn analysis result of Cytoscape plugins CytoHabba and MCODE", "structure": {"pmcid": "PMC8182989", "section_index": 20, "section_title": "PPI network construction and module analysis of DEGs", "row_count": 4, "column_count": 3}, "table": {"label": "Table 4", "caption": "The Venn analysis result of Cytoscape plugins CytoHabba and MCODE", "rows": [["Names", "Total", "Elements"], ["CytoHubba and MCODE", "6", "ADCY8, ADRB2, CALCA, GCG, GNGT1, NPSR1"], ["CytoHubba", "14", "ADCY8, ADRB1, ADRB2, CALCA, CALCRL, GCG, CGA, GNGT1, NPSR1, RAMP2, RAMP3, RXFP1, RXFP2, VIPR1"], ["MCODE", "10", "ADCY8, ADRB2, ALB, CALCA, F2, GCG, GNGT1, INS, NPSR1, SST"]], "row_count": 4, "column_count": 3, "numeric_cells": 3, "header_rows": 1, "locator": "section[20]/table-wrap[1]#T4"}}, {"id": "asset:table:pmid:34017995:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f7ca0937d568a0a6ee66e273fe06ca889d2003a77e184bedffa97e64d3213596", "bytes": 13026, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[1]#T5", "version": null, "note": "The Venn analysis result of GSE118370, GSE136043, and GSE140797 datasets in GEO database", "structure": {"pmcid": "PMC8182989", "section_index": 21, "section_title": "The verification results of GEO database", "row_count": 5, "column_count": 3}, "table": {"label": "Table 5", "caption": "The Venn analysis result of GSE118370, GSE136043, and GSE140797 datasets in GEO database", "rows": [["Names", "Total", "Elements"], ["GSE118370, GSE136043, GSE140797", "77", "ABCC3, ACADL, ADCY8, ADH1B, ADRB2, AGER, AGR2, ANKRD29, AOC3, AQP4, ARHGAP6, ASPA, BTNL9, CALCA, CAV1, CCDC85A, CD24, CD36, CDO1, CLDN18, CLIC5, COL10A1, COL13A1, COL6A6, CP, DACH1, DPP6, EMCN, EMP2, FLJ34503, FMO2, FOXF1, FRMD3, GCG, GJB2, GNGT1, GPC3, GPM6A, GRK5, HHIP, IGSF10, ITGA8, KANK3, KIAA1462, LAMA3, LDB2, LOC400568, MFAP4, MYOC, MYZAP, NPSR1, NTNG1, PDE5A, PKHD1L1, RASIP1, RBP2, ROBO4, RTKN2, SCN7A, SEMA5A, SGCG, SGPP2, SIX1, SLIT2, SPINK1, SPOCK2, SSTR1, SVEP1, TBX3, TCF21, TEK, TMEM100, TMPRSS4, TNXB, TTN, VGLL3, WFDC2"], ["GSE118370", "407", "ABCA6, ABCA9, ABCC3, ABI3BP, ACADL, ACE, ACSS3, ACTN2, ACVRL1, ADAMTS17, ADAMTS7, ADARB1, ADCY8, ADGRL2, ADGRL3, ADH1B, ADRA1A, ADRB2, AFAP1-AS1, AFAP1L1, AGAP11, AGER, AGR2, AKAP12, AKAP2, ALX1, AMER2, ANGPT1, ANKRD29, ANXA8L1, AOC3, APOL3, AQP3, AQP4, ARHGAP29, ARHGAP6, ARHGEF15, ARHGEF26, ARHGEF33, ART4, ASPA, AXIN2, B3GALT5-AS1, B4GALNT3, BAALC, BCL6B, BEX1, BICDL1, BLACAT1, BMP1, BTNL9, C10orf25, C10orf91, C12orf74, C19orf84, C1orf53, CA2, CADM3-AS1, CALCA, CALCRL, CASP12, CAV1, CCBE1, CCDC68, CCDC85A, CCM2L, CD24, CD300LG, CD36, CD93, CDH5, CDO1, CDT1, CEACAM6, CEACAM7, CHRNA4, CLDN18, CLEC1A, CLIC5, CLIC6, CNTLN, COL10A1, COL13A1, COL4A6, COL6A6, CORO6, CP, CYTH4, CYYR1, DACH1, DMRTC1B, DPP6, DSCC1, DST, DUOX1, ECSCR, EDNRB, EFCC1, EMCN, EML1, EMP2, EPAS1, EPB41L2, EPT1, ERG, ERICH4, EYA4, FABP4, FAM107A, FAM124B, FAM135B, FAM65A, FAM83A, FAM83H, FAT3, FBXO40, FCN3, FENDRR, FGD5, FGFR4, FHL1, FHL5, FLI1, FLJ34503, FMO2, FOXF1, FPR1, FRMD3, GALNT13, GBP4, GCG, GDF15, GHR, GIMAP1, GIMAP8, GJB2, GNGT1, GNLY, GPC3, GPM6A, GPR182, GPX3, GRIA1, GRK5, GRM8, GSTM5, GUCY1A2, GYG2, GZMB, HABP2, HBA2, HBB, HCN3, HEG1, HHIP, HIF3A, HMGCLL1, HOXA10-HOXA9, HSPB6, HSPC324, IGHA2, IGHV4-31, IGK, IGKC, IGLJ3, IGSF10, IL18RAP, IL1RL1, IL23A, IL7R, ILDR1, INSC, IQGAP3, ITGA8, JAM2, KANK3, KCNB1, KCNK3, KCNT2, KCTD16, KIAA0087, KIAA1462, KIAA1614, KIF18B, KIF26B, KL, KLF13, KLF15, KLF4, KLRC3, KLRD1, KLRF1, KRT6A, LAMA3, LAMA4, LAPTM4B, LCAL1, LCNL1, LDB2, LDHAL6A, LEPROT, LIMK1, LIN7A, LINC00052, LINC00312, LINC00472, LINC00643, LINC00842, LINC00845, LINC00961, LINC00968, LINC01021, LINC01123, LINC01545, LOC100506725, LOC100507487, LOC100996760, LOC101927699, LOC101928161, LOC101928307, LOC101928417, LOC101929398, LOC101929486, LOC101930541, LOC102725051, LOC105379426, LOC285147, LOC400568, LOC400794, LTBP4, LYVE1, MACF1, MAOB, MAPRE2, MBD5, MCEMP1, MCOLN3, MEIS1, MESDC1, MFAP4, MGST1, MIR1204, MME, MMP1, MMP7, MRAP, MSMB, MTO1, MUC3, MUC3B, MYCT1, MYOC, MYZAP, NAALAD2, NAV2-IT1, NDRG2, NDRG4, NECAB2, NECTIN4, NEGR1, NEK2, NFASC, NOTCH4, NOVA2, NPR1, NPSR1, NQO1, NR5A2, NRG3, NTNG1, NTNG2, NTRK2, OR5E1P, OR5P2, OR5P3, OR6W1P, P2RY1, PAPOLB, PCAT19, PCDH15, PDE5A, PDE8B, PDGFB, PDK4, PDLIM3, PECAM1, PGR, PIR-FIGF, PKHD1L1, PPBP, PPP1R14A, PRF1, PRKCB, PROM2, PRPH, PRX, PTPRB, PTPRS, QKI, RAMP3, RASEF, RASIP1, RBP2, RGCC, RHOJ, RNF152, ROBO4, RTKN2, RXFP1, RYR2, S100B, S1PR1, S1PR5, SCARA5, SCN10A, SCN7A, SCNN1A, SDPR, SEC14L1, SEMA3G, SEMA5A, SEMA6D, SERPIND1, SFTPC, SGCG, SGPP2, SH2D3C, SH3GL3, SHANK3, SHROOM4, SIX1, SLC14A1, SLC19A3, SLC5A9, SLC6A4, SLCO2A1, SLIT2, SLIT3, SMAD6, SMAD9, SMPDL3B, SOX17, SOX7, SPDEF, SPINK1, SPOCK2, SPTBN1, SRCIN1, SSTR1, STARD13, STARD13-AS, STX11, STXBP6, SULT1C4, SUSD4, SV2C, SVEP1, SYCP2L, SYN2, TAS1R1, TBX2, TBX3, TBX4, TCEAL2, TCF21, TEK, TFAP2A, TGFBR3, TIE1, TIMP3, TMC2, TMEM100, TMEM246, TMEM252, TMEM45B, TMEM47, TMEM74, TMEM74B, TMEM75, TMIE, TMPRSS4, TMTC1, TNNC1, TNR, TNXB, TOX3, TRDV3, TRHDE, TRHDE-AS1, TRIM58, TRPA1, TRPC6, TTC16, TTLL7, TTN, URB1, VGLL3, VIPR1, VWF, WFDC2, WISP2, WNT7B, ZNF366, ZNF471, ZNF662, ZNF677, ZPLD1"], ["GSE136043", "554", "AATK, ABCA12, ABCB1, ABCC3, ABLIM3, ACADL, ACAN, ACAP3, ADAM8, ADAMTS14, ADAMTS16, ADAMTS8, ADAMTSL3, ADCY8, ADH1A, ADH1B, ADM2, ADORA3, ADRA1D, ADRB2, AGER, AGR2, AGTR1, AHNAK, AKNA, AKR1B10, ANKFN1, ANKRD18B, ANKRD20A2, ANKRD20A5P, ANKRD20A9P, ANKRD22, ANKRD29, ANXA10, ANXA3, AOC3, AOX1, APEH, APLN, AQP4, AQP6, ARHGAP6, ARHGEF16, ARHGEF19, ARHGEF26, ASPA, ASPHD1, ASS1, ATL2, ATP10B, B3GAT1, B3GNT3, BAI3, BCAS1, BCL6B, BDNF, BIK, BPIFA1, BPIFB1, BTNL8, BTNL9, C10orf116, C10orf140, C10orf67, C10orf81, C12orf39, C1orf81, C1QTNF4, C1QTNF7, C20orf202, C2CD4A, C4orf49, C6orf174, C6orf222, C8B, C9orf125, C9orf129, C9orf140, CA4, CADM3, CALCA, CAMK1D, CAMK2N1, CAPN13, CAPN8, CASP12, CASR, CAV1, CAV2, CAV3, CCDC129, CCDC48, CCDC85A, CCK, CCL20, CCL24, CCNO, CCRL1, CD180, CD24, CD36, CD79A, CDCA7, CDH13, CDH3, CDO1, CEACAM1, CEACAM3, CEACAM5, CEACAM6, CEACAM7, CES1, CFD, CHAC1, CHRDL1, CHRM1, CKMT1A, CLDN18, CLDN4, CLEC1B, CLEC3B, CLIC5, CLIC6, CNOT3, CNTN6, CNTNAP3, COL10A1, COL13A1, COL17A1, COL24A1, COL6A6, COMP, COPG2IT1, COX2, CP, CPB2, CPNE4, CPNE5, CPNE7, CST6, CT45A5, CXCL13, CXCL14, CYP1B1, CYP27B1, DACH1, DCDC2, DEFA3, DEFA4, DEPTOR, DERL3, DFNB31, DLX5, DMRT2, DNASE1L3, DPEP3, DPP6, DPT, DSP, E2F8, ECEL1P2, EDN3, EFNB3, EHF, ELF3, ELFN2, ELMOD1, EMCN, EMP2, EPHA10, EPN3, ERN2, ERV18-1, FAM105A, FAM150B, FAM155B, FAM162B, FAM189A2, FAM84A, FBLIM1, FBN3, FCGBP, FER1L4, FERMT2, FGD5, FGF12, FGF2, FGL1, FHL2, FIBIN, FIGF, FLJ13744, FLJ30901, FLJ34503, FLJ44635, FMO2, FOXF1, FOXF2, FRAS1, FRMD3, FRMD5, FUT1, FUT3, FUT8, FZD10, GAPDH, GCG, GDF10, GHR, GJB2, GJC2, GKN2, GMDS, GNG11, GNGT1, GOLGA7B, GOLM1, GPA33, GPC3, GPC5, GPIHBP1, GPM6A, GPR110, GPR158, GPR160, GPR4, GPT2, GREM1, GRIA1, GRIP1, GRK5, GRRP1, GSTA2, GSTA5, HAMP, HAS1, HCN4, HDGF, HES7, HHIP, HIGD1B, HMGB3, HNRNPH1, HOXA4, HOXA5, HS3ST1, HS6ST2, HSH2D, HSPA12B, IER3, IFITM1, IGFBP2, IGSF10, IGSF9, IHH, IL16, IL20RA, INHBB, INMT, ISYNA1, ITGA8, ITLN1, ITLN2, IYD, JAKMIP2, KAL1, KANK3, KANK4, KCNA4, KCNK12, KDELR3, KHDRBS2, KIAA1217, KIAA1324, KIAA1462, L1TD1, LAD1, LAMA3, LCN2, LDB2, LEMD1, LEPR, LGALS4, LGR4, LIN7A, LINC00163, LINC00472, LINGO1, LMF1, LOC100127983, LOC100128905, LOC100129463, LOC100130428, LOC100130899, LOC100131094, LOC100133669, LOC100192426, LOC100505933, LOC100507055, LOC158376, LOC283392, LOC284080, LOC338653, LOC388906, LOC389023, LOC389033, LOC389332, LOC400550, LOC400568, LOC553137, LOC572558, LOC643650, LOC643988, LOC645431, LOC646324, LOC646513, LOC729860, LOC731424, LOC91948, LPHN2, LPL, LRP4, LRRC15, LRRC19, LRRC31, LRRN3, LRRN4CL, LRRTM4, LTF, LUZP2, LYG2, LYPD5, MAGED4B, MAL, MAMDC2, MAMDC4, MANEAL, MAP7D2, MAPK4, MARCO, MDK, MEF2D, MESP1, MESP2, MFAP4, MFSD6L, MGAT3, MGC20647, MIOX, MME, MMP11, MMP12, MNX1, MOGAT1, MPP6, MS4A15, MSR1, MUC4, MX2, MYH2, MYOC, MYOM2, MYZAP, NCKAP5, NDNF, NDRG4, NECAB1, NGEF, NHS, NOS1AP, NOS2, NOV, NPSR1, NR5A2, NRG1, NTNG1, OCIAD2, ODAM, OR5L2, OTX1, OVOL1, P2RY1, PAX9, PCA3, PCDH9, PCM1, PCOLCE2, PDE1C, PDE5A, PDE6A, PEAR1, PHLDA2, PIN1P1, PIP5K1B, PITPNM2, PITX1, PITX2, PKHD1L1, PKIB, PKNOX2, PLAC9, PLEKHH2, PLIN5, PNMA6C, POPDC3, POU3F2, PPARGC1A, PPDPF, PPP1R17, PRKG2, PROM1, PROS1, PRSS50, PSAPL1, PSAT1, PTN, PTPRD, PTPRZ1, PVRL4, PYCR1, QRFPR, RAB26, RADIL, RAG1, RALGPS2, RAMP1, RANBP3L, RAPH1, RASIP1, RBP2, RECK, REEP6, RET, RETN, RGS17, RGS9BP, RHBDL2, RN28S1, RNASE13, RNF122, RNF182, ROBO4, RPL28, RSPO1, RSPO2, RTKN2, RUNDC3B, RUNX1, S100A3, S100B, SAA1, SAA2, SAA4, SALL4, SBK1, SCD5, SCEL, SCN3B, SCN4B, SCN7A, SEMA3B, SEMA3D, SEMA3E, SEMA5A, SERTM1, SGCG, SGPP2, SH2D1B, SH3GL2, SH3GL3, SIDT1, SIX1, SIX4, SLC15A1, SLC16A12, SLC19A3, SLC1A1, SLC1A7, SLC22A18, SLC22A18AS, SLC2A5, SLC39A8, SLC44A4, SLC46A2, SLC7A5, SLC8A2, SLCO4C1, SLIT2, SMOX, SNCB, SOSTDC1, SOX2, SOX7, SPINK1, SPOCK2, SPP1, SPRYD7, SPTBN1, SPTBN2, SRRM4, SSTR1, ST6GALNAC1, ST6GALNAC5, STEAP3, STRA6, STXBP6, SUN1, SUSD4, SVEP1, SYNM, SYNPO2L, SYT12, TAL1, TBX3, TBX4, TCEA2, TCF21, TEK, TFF3, TGM1, TINAGL1, TMEM100, TMEM132C, TMEM139, TMEM238, TMEM63A, TMEM63C, TMPRSS4, TNNC1, TNXB, TOX3, TSPAN1, TTC39A, TTI2, TTN, TUSC1, UACA, UNC5CL, USHBP1, VEGFA, VGLL3, VPREB3, VSTM2L, VTCN1, VWF, WFDC2, WIF1, WNK2, WNT3A, ZBED2, ZNF331, ZNF365, ZNF534, ZNF626"], ["GSE140797", "641", "ABCA12, ABCA4, ABCA6, ABCA8, ABCB4, ABCC3, ABLIM3, ACACB, ACADL, ACOXL, ACTG2, ACVRL1, ADAMDEC1, ADAMTS14, ADAMTS8, ADARB1, ADCY8, ADH1A, ADH1B, ADM2, ADRB1, ADRB2, AGER, AGR2, AGTR1, AIM2, AK4, AKNAD1, AKR1B10, AKR1B15, ANGPT1, ANGPTL1, ANGPTL7, ANKRD20A2, ANKRD20A9P, ANKRD29, ANKRD30BP2, ANKRD34B, ANLN, ANXA8L2, AOC3, APOE, AQP4, ARAP3, ARHGAP29, ARHGAP6, ARHGEF16, ARHGEF4, ASPA, ASPM, ATP10B, ATP1A2, AURKAPS1, B3GNT3, BAALC, BCHE, BEX1, BIRC5, BMPER, BMPR2, BNIP2, BPIFA1, BRIP1, BTNL3, BTNL9, BUB1, C10orf116, C10orf67, C10orf81, C11orf88, C12orf39, C14orf132, C15orf48, C18orf56, C1orf173, C1orf194, C1orf81, C20orf160, C2orf40, C4orf7, C5orf4, C6orf174, C6orf222, C6orf225, C8B, C9orf125, C9orf85, CA4, CABYR, CACNA2D2, CADM1, CALCA, CALCRL, CAMK2N1, CAMP, CASQ2, CAV1, CAV2, CAV3, CBFA2T3, CCDC129, CCDC147, CCDC48, CCDC68, CCDC85A, CCL14, CCL19, CCL23, CCL7, CCNB2, CCNE1, CCNO, CD24, CD36, CDC45, CDCA2, CDCA3, CDCA5, CDCA7, CDH13, CDH19, CDHR4, CDKN2A, CDKN3, CDO1, CDT1, CEACAM3, CEACAM5, CENPA, CENPF, CENPM, CEP55, CFD, CGNL1, CHI3L1, CHIA, CHRDL1, CHRM1, CILP, CIT, CKM, CLDN18, CLDN3, CLEC1B, CLEC3B, CLIC5, CNTNAP2, COL10A1, COL13A1, COL17A1, COL1A1, COL28A1, COL3A1, COL4A3, COL6A6, COMP, COPG2IT1, COX7A1, CP, CPB2, CR2, CRABP2, CRTAC1, CTHRC1, CTLA4, CX3CR1, CXCL10, CXCL13, CXCL14, CXCL9, CXCR5, CXorf41, CXorf61, CYP3A5, CYP4B1, CYS1, CYYR1, DACH1, DACT2, DCDC2B, DES, DFNB31, DIXDC1, DLGAP5, DLX5, DMRT2, DMRTA2, DNAH12, DNASE1L3, DPP6, DUOX1, DUSP10, E2F8, ECEL1P2, ECSCR, EDN2, EDNRB, EEF1A2, EFCAB1, EGFL7, ELF3, EMCN, EMP2, ENPP3, EPAS1, EPHA10, ERCC6L, ERN2, ESCO2, ETS2, ETV1, EXO1, EZH2, F11, FABP4, FAM105A, FAM107A, FAM13C, FAM150B, FAM162B, FAM167A, FAM189A2, FAM3D, FANCA, FAP, FBLIM1, FCN3, FCRL4, FCRL5, FER1L4, FEZ1, FGF2, FHL1, FIBIN, FIGF, FLJ13744, FLJ30901, FLJ34503, FMO2, FOXF1, FRMD3, FRMD5, FRY, FUT3, FZD4, GAD1, GALNTL4, GAPDH, GCG, GDA, GDF10, GDF15, GENE_SYMBOL, GFOD1, GIMAP8, GINS1, GJB2, GJC2, GKN2, GLDN, GNAZ, GNG11, GNGT1, GOLGA7B, GPC3, GPER, GPIHBP1, GPM6A, GPM6B, GPR110, GPR133, GPRIN2, GPX3, GRASP, GREM1, GRK5, GRRP1, GSDMC, GUCY1B2, HAMP, HBA2, HBB, HBD, HBG1, HCAR3, HECW2, HEG1, HHIP, HIGD1B, HIST1H2AI, HJURP, HLF, HMGA2, HMGB3, HORMAD1, HPGD, HRASLS2, HS6ST2, HSD17B6, HSPA12B, HSPB2, IGF2BP3, IGFBP1, IGFBP3, IGFL2, IGLL1, IGLL5, IGSF10, IGSF9, IL18R1, IL1RL1, IL2RA, IL4I1, IL7R, INHBB, INMT, IRX1, IRX2, ITGA10, ITGA8, ITLN1, ITLN2, JAM2, JPH4, KAL1, KANK3, KANK4, KCNB1, KCNN4, KDELR2, KHDRBS2, KIAA0408, KIAA1324L, KIAA1462, KIF18A, KIF23, KISS1R, KLRD1, KRT14, KRT15, KRT17, KRT23, KRT8, KRT80, KRT8P12, L1TD1, LAD1, LAMA3, LAMP3, LCN2, LDB2, LEMD1, LEPR, LGALS4, LGI2, LGSN, LHFP, LIFR, LILRB4, LIMCH1, LIMS2, LINC00261, LINC00312, LINGO1, LOC100127983, LOC100129940, LOC100131395, LOC254896, LOC283392, LOC284080, LOC284276, LOC389023, LOC400550, LOC400568, LOC400891, LOC643037, LOC645431, LOC729860, LPL, LRRC10B, LRRC36, LRRK2, LRRN3, LTF, LY6K, LYPD1, LYVE1, MAGEA6, MAMDC2, MAOA, MAP3K15, MAPK4, MARCO, MATN3, MDK, MELK, MEX3A, MFAP4, MGAT3, MIOX, MIR205HG, MLF1IP, MMP1, MMP11, MMP12, MMP13, MMP7, MMP9, MMRN1, MND1, MNX1, MOGAT1, MS4A15, MSRB3, MUC16, MUC21, MUC4, MYH10, MYH11, MYH2, MYOC, MYOM2, MYZAP, MZB1, NCKAP5, NDC80, NECAB1, NEDD4L, NEIL3, NEK2, NEXN, NMNAT2, NOSTRIN, NOTCH4, NOTUM, NPNT, NPR3, NPSR1, NPY1R, NTNG1, NTRK3, NUF2, NUSAP1, NXPH4, OCA2, ODZ2, OGN, PABPC1L, PADI1, PAQR5, PAX9, PBK, PCDH7, PCOLCE2, PCSK9, PDE1C, PDE5A, PDE8B, PDK4, PDZD2, PDZRN4, PEBP4, PECAM1, PHLDA2, PI16, PIK3R1, PITX1, PITX2, PKHD1L1, PLA2G1B, PLAC9, PLAU, PLCXD3, PLEKHH2, POU2AF1, PP14571, PPP1R3C, PRKCE, PRSS22, PSCA, PTCH1, PTGFR, PTPN21, PTPRB, PTPRM, PTPRQ, PVRL4, PYCR1, RAB26, RAD54L, RADIL, RALGPS2, RASIP1, RBP2, RECK, RECQL4, REG1A, RETN, RGS1, RHBDL2, RNF182, RNFT2, ROBO4, RP11-165H20.1, RSPO2, RTKN2, RUNX1, RXFP1, S100A2, S100P, S1PR1, SALL4, SCARA5, SCN1A, SCN4B, SCN7A, SDPR, SEC14L3, SEC14L4, SELENBP1, SEMA3E, SEMA3G, SEMA5A, SEPP1, SFN, SFTPD, SGCA, SGCG, SGPP2, SH2D3C, SHANK3, SIX1, SIX4, SLC14A1, SLC16A12, SLC17A9, SLC1A1, SLC2A1, SLC39A8, SLC5A8, SLC6A4, SLC7A11, SLCO2A1, SLIT2, SLIT3, SLITRK3, SMAD6, SMAD9, SNX1, SNX22, SOSTDC1, SPAG5, SPARCL1, SPINK1, SPOCK2, SPOCK3, SPP1, SPRYD7, SSTR1, ST6GALNAC1, STAC, STARD9, STEAP1, STIL, STRA6, STX1A, STYK1, SULF1, SULT1C2, SUSD2, SVEP1, SYCP3, SYN2, SYNE1, SYNM, SYNPO2, SYNPO2L, SYT12, TAL1, TBC1D3B, TBC1D3G, TBX2, TBX3, TCAM1P, TCF21, TCN1, TDO2, TDRD1, TEK, TEKT5, THBD, THBS2, THSD4, THY1, TIMP1, TIMP3, TK1, TMEM100, TMEM45B, TMEM47, TMEM63C, TMPRSS4, TMSB15A, TNS4, TNXB, TOP2A, TPPP, TSPAN12, TTK, TTN, TUBB1, TUBB2B, TUBB3, TWIST1, TYMS, UBD, UBE2C, UBE2T, UCK2, UHRF1, VAPA, VEPH1, VGF, VGLL3, VIL1, VIPR1, VMP1, VSTM2L, WDR16, WDR17, WFDC2, WIF1, WISP2, WNT3A, XAGE1A, XDH, ZBED2, ZNF300P1, ZNF385B, ZWINT, ZYG11A"]], "row_count": 5, "column_count": 3, "numeric_cells": 12, "header_rows": 1, "locator": "section[21]/table-wrap[1]#T5"}}, {"id": "asset:table:pmid:34017995:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0997e170b1b42bea4568bb0f5d6b7cb8704bce4f12a0996902f2259a5da1946f", "bytes": 3150, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[2]#T6", "version": null, "note": "GO analysis and KEGG pathway analysis of 77 common DEGs in 3 GEO datasets", "structure": {"pmcid": "PMC8182989", "section_index": 21, "section_title": "The verification results of GEO database", "row_count": 46, "column_count": 5}, "table": {"label": "Table 6", "caption": "GO analysis and KEGG pathway analysis of 77 common DEGs in 3 GEO datasets", "rows": [["Category", "GO ID", "Term", "Count", "P value"], ["BP", "GO:0007155", "Cell adhesion", "12", "2.86E-06"], ["BP", "GO:0030198", "Extracellular matrix organization", "6", "0.001"], ["BP", "GO:0001525", "Angiogenesis", "6", "0.002"], ["BP", "GO:0007267", "Cell–cell signaling", "6", "0.004"], ["BP", "GO:0016337", "Single organismal cell–cell adhesion", "5", "8.34E-04"], ["BP", "GO:0001570", "Vasculogenesis", "4", "0.002"], ["BP", "GO:0001666", "Response to hypoxia", "4", "0.035"], ["BP", "GO:0001763", "Morphogenesis of a branching structure", "3", "4.72E-04"], ["BP", "GO:0001958", "Endochondral ossification", "3", "0.005"], ["BP", "GO:0007188", "Adenylate cyclase-modulating G-protein coupled receptor signaling pathway", "3", "0.010"], ["BP", "GO:0010811", "Positive regulation of cell–substrate adhesion", "3", "0.011"], ["BP", "GO:0001657", "Ureteric bud development", "3", "0.011"], ["BP", "GO:0007190", "Activation of adenylate cyclase activity", "3", "0.012"], ["BP", "GO:0001658", "Branching involved in ureteric bud morphogenesis", "3", "0.013"], ["BP", "GO:0031623", "Receptor internalization", "3", "0.014"], ["BP", "GO:0007189", "Adenylate cyclase-activating G-protein coupled receptor signaling pathway", "3", "0.018"], ["BP", "GO:0008104", "Protein localization", "3", "0.027"], ["BP", "GO:0030574", "Collagen catabolic process", "3", "0.029"], ["BP", "GO:0043627", "Response to estrogen", "3", "0.030"], ["BP", "GO:0030334", "Regulation of cell migration", "3", "0.038"], ["BP", "GO:0051897", "Positive regulation of protein kinase B signaling", "3", "0.048"], ["BP", "GO:0045986", "Negative regulation of smooth muscle contraction", "2", "0.017"], ["BP", "GO:0070836", "Caveola assembly", "2", "0.021"], ["BP", "GO:0043549", "Regulation of kinase activity", "2", "0.021"], ["BP", "GO:0060426", "Lung vasculature development", "2", "0.025"], ["BP", "GO:0048251", "Elastic fiber assembly", "2", "0.029"], ["BP", "GO:0002024", "Diet-induced thermogenesis", "2", "0.037"], ["BP", "GO:0030857", "Negative regulation of epithelial cell differentiation", "2", "0.045"], ["BP", "GO:0045779", "Negative regulation of bone resorption", "2", "0.049"], ["BP", "GO:0001944", "Vasculature development", "2", "0.049"], ["CC", "GO:0005886", "Plasma membrane", "28", "0.0029"], ["CC", "GO:0005576", "Extracellular region", "17", "3.80E-04"], ["CC", "GO:0005615", "Extracellular space", "12", "0.015"], ["CC", "GO:0005887", "Integral component of plasma membrane", "11", "0.047"], ["CC", "GO:0009986", "Cell surface", "8", "0.005"], ["CC", "GO:0005578", "Proteinaceous extracellular matrix", "7", "6.16E-04"], ["CC", "GO:0045121", "Membrane raft", "5", "0.009"], ["CC", "GO:0005581", "Collagen trimer", "4", "0.006"], ["CC", "GO:0005667", "Transcription factor complex", "4", "0.040"], ["CC", "GO:0045177", "Apical part of cell", "3", "0.035"], ["MF", "GO:0008201", "Heparin binding", "4", "0.024"], ["KEGG", "hsa04151", "PI3K-Akt signaling pathway", "6", "0.044"], ["KEGG", "hsa04512", "ECM–receptor interaction", "5", "0.001"], ["KEGG", "hsa04510", "Focal adhesion", "5", "0.028"], ["KEGG", "hsa05414", "Dilated cardiomyopathy", "4", "0.012"]], "row_count": 46, "column_count": 5, "numeric_cells": 135, "header_rows": 1, "locator": "section[21]/table-wrap[2]#T6"}}, {"id": "asset:table:pmid:34017995:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:78aea2f619fd47301803e349e4ed9c3e4c1b3f1a81858d91ece76a58f006d286", "bytes": 1565, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[27]/table-wrap[1]#T7", "version": null, "note": "The clinicopathologic features of LUAD patients in TCGA database", "structure": {"pmcid": "PMC8182989", "section_index": 27, "section_title": "Relationship between the 6 hub genes and clinical features in LUAD patients", "row_count": 14, "column_count": 15}, "table": {"label": "Table 7", "caption": "The clinicopathologic features of LUAD patients in TCGA database", "rows": [["Clinical characteristics", "Subgroup", "Total (N)", "Expression of ADCY8", "Expression of ADRB2", "Expression of CALCA", "Expression of GCG", "Expression of GNGT1", "Expression of NPSR1"], ["", "", "", "Low", "High", "Low", "High", "Low", "High", "Low", "High", "Low", "High", "Low", "High"], ["Age", "≤65", "233", "172", "61", "119", "114", "119", "114", "102", "131", "117", "116", "173", "60"], ["", ">65", "237", "162", "75", "115", "122", "115", "122", "132", "105", "117", "120", "161", "76"], ["Gender", "male", "223", "102", "121", "126", "97", "105", "118", "121", "102", "111", "112", "108", "115"], ["", "female", "266", "141", "125", "118", "148", "265", "1", "122", "144", "132", "134", "135", "131"], ["Primary tumor", "T1-2", "426", "185", "241", "181", "245", "228", "198", "222", "204", "221", "205", "227", "199"], ["", "T3-4", "60", "41", "19", "50", "10", "24", "36", "30", "30", "21", "39", "20", "40"], ["Nodal metastasis", "N0", "317", "152", "165", "141", "176", "223", "94", "180", "157", "186", "121", "177", "140"], ["", "N1-3", "158", "89", "69", "96", "62", "44", "114", "37", "121", "51", "107", "60", "98"], ["Distant metastasis", "M0", "333", "144", "189", "135", "198", "193", "140", "188", "145", "173", "160", "184", "149"], ["", "M1", "24", "19", "5", "20", "4", "6", "18", "7", "17", "9", "15", "11", "13"], ["Stage", "I-II", "378", "177", "201", "163", "215", "208", "170", "201", "177", "197", "181", "204", "174"], ["", "III-IV", "103", "63", "40", "76", "27", "42", "61", "39", "64", "43", "60", "36", "67"]], "row_count": 14, "column_count": 15, "numeric_cells": 161, "header_rows": 2, "locator": "section[27]/table-wrap[1]#T7"}}, {"id": "asset:table:pmid:34017995:8", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:3287c0634185b1b87739352463407557564937e4eb7eea9e0a8686089ca6ce20", "bytes": 1132, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[27]/table-wrap[2]#T8", "version": null, "note": "Correlation between 6 hub genes expression and the clinicopathologic features of LUAD patients", "structure": {"pmcid": "PMC8182989", "section_index": 27, "section_title": "Relationship between the 6 hub genes and clinical features in LUAD patients", "row_count": 7, "column_count": 8}, "table": {"label": "Table 8", "caption": "Correlation between 6 hub genes expression and the clinicopathologic features of LUAD patients", "rows": [["Clinical characteristics", "Total (N)", "OR in ADCY8 expression", "P value", "OR in ADRB2 expression", "P value", "OR in CALCA expression", "P value"], ["Age (≥65 vs. <65)", "470", "1.31 (0.87–1.95)", "0.191", "1.11 (0.77–1.59)", "0.580", "1.11 (0.77–1.59)", "0.580"], ["Gender (male vs. female)", "489", "0.75 (0.52–1.07)", "0.109", "1.63 (1.14–2.33)", "0.007", "0.01 (0.00–0.02)", "0.000"], ["Primary tumor (T1-2 vs. T3-4)", "486", "0.36 (0.20–0.63)", "0.000", "0.15 (0.07–0.30)", "0.000", "1.73 (1.00–3.00)", "0.054"], ["Nodal metastasis (N0 vs. N1-3)", "475", "0.71 (0.49–1.05)", "0.098", "0.52 (0.35–0.76)", "0.001", "6.15 (4.03–9.38)", "0.000"], ["Distant metastasis (M0 vs. M1)", "357", "0.20 (0.07–0.55)", "0.001", "0.14 (0.05–0.41)", "0.000", "4.14 (1.60–10.69)", "0.002"], ["Stage (I-II vs. III-VI)", "481", "0.56 (0.36–0.87)", "0.011", "0.27 (0.17–0.44)", "0.000", "1.78 (1.14–2.77)", "0.011"]], "row_count": 7, "column_count": 8, "numeric_cells": 45, "header_rows": 1, "locator": "section[27]/table-wrap[2]#T8"}}], "gaps": ["asset:data:geo:GSE118370 not downloaded", "asset:data:geo:GSE118370 licence not read", "asset:data:geo:GSE136043 not downloaded", "asset:data:geo:GSE136043 licence not read", "asset:data:geo:GSE140797 not downloaded", "asset:data:geo:GSE140797 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "edger", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Differential expression analysis of individual genes was carried out by edgeR Bioconductor package [14]."}}, {"id": "method-2", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-3", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "PPI"}}, {"id": "method-4", "family": "diagnostic_evaluation", "specific": "roc", "label": "Diagnostic test evaluation", "dsl_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["reference_standard_and_test"], "evidence": {"score": 0.8, "band": "high", "quote": "ROC curve"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: edger."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE118370", "GSE136043", "GSE140797"], "resolved_accessions": ["GSE118370", "GSE136043", "GSE140797"], "statements": ["High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO."], "basis": "The paper names GSE118370, GSE136043, GSE140797 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:34017995", "data:geo:GSE118370", "asset:table:pmid:34017995:1", "asset:table:pmid:34017995:2", "asset:table:pmid:34017995:3", "asset:table:pmid:34017995:4", "asset:table:pmid:34017995:5", "asset:table:pmid:34017995:6", "asset:table:pmid:34017995:7", "asset:table:pmid:34017995:8"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE118370"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:30:14Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 39324, "completion_tokens": 2252, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34017995", "type": "paper", "label": "pmid:34017995"}, {"id": "source:pmid:34017995", "type": "manuscript", "label": "PMID 34017995 full text"}, {"id": "data:geo:GSE118370", "type": "dataset", "label": "GEO GSE118370"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34017995", "type": "paper", "label": "pmid:34017995"}, {"id": "source:pmid:34017995", "type": "manuscript", "label": "PMID 34017995 full text"}, {"id": "data:geo:GSE118370", "type": "dataset", "label": "GEO GSE118370"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34017995", "type": "extraction", "used": ["source:pmid:34017995"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE118370", "type": "accession_resolution", "used": ["data:geo:GSE118370"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34017995", "parent_hash": "sha256:75253f3543859bd3f2dde2ec69fc50aefebb8e424065cba762f521e1860ebf1a", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE118370 licence not read", "asset:data:geo:GSE118370 not downloaded", "asset:data:geo:GSE136043 licence not read", "asset:data:geo:GSE136043 not downloaded", "asset:data:geo:GSE140797 licence not read", "asset:data:geo:GSE140797 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Differential expression analysis of individual genes was carried out by edgeR Bioconductor package [14]."], "order_basis": "analysis_only", "id": "assay:1"}]}