Oncogenic role of ALX3 in cervical cancer cells through KDM2B-mediated histone demethylation of CDC25A.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34266408", "kind": "science-record", "revision": 7, "content_hash": "sha256:849e19661fdf9a27aaccd0a5422d3a0da717bfedb204a437ab034df4975d9684", "created_at": "2026-11-01T15:41:43Z", "updated_at": "2026-11-01T22:04:14Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Oncogenic role of ALX3 in cervical cancer cells through KDM2B-mediated histone demethylation of CDC25A.", "doi": "10.1186/s12885-021-08552-7", "pmid": "34266408", "authors": ["Jinhong Qi", "Li Zhou", "Dongqing Li", "Jingyuan Yang", "He Wang", "Huifang Cao", "Yunlan Huang", "Zhiming Zhang", "Linlin Chang", "Chenhao Zhu", "Juntong Zhan", "Yong Yuan"], "journal": "BMC cancer", "year": 2021, "abstract": "BACKGROUND: Cell division cycle 25A (CDC25A) is a well-recognized regulator of cell cycle progression and is involved in cancer development. This work focused on the function of CDC25A in cervical cancer cell growth and the molecules involved.\nMETHODS: A GEO dataset GSE63514 comprising data of cervical squamous cell carcinoma (CSCC) tissues was used to screen the aberrantly expressed genes in cervical cancer. The CDC25A expression in cancer and normal tissues was predicted in the GEPIA database and that in CSCC and normal cells was determined by RT-qPCR and western blot assays. Downregulation of CDC25A was introduced in CSCC cells to explore its function in cell growth and the cell cycle progression. The potential regulators of CDC25A activity and the possible involved signaling were explored.\nRESULTS: CDC25A was predicted to be overexpressed in CSCC, and high expression of CDC25A was observed in CSCC cells. Downregulation of CDC25A in ME180 and C33A cells reduced cell proliferation and blocked cell cycle progression, and it increased cell apoptosis. ALX3 was a positive regulator of CDC25A through transcription promotion. It recruited a histone demethylase, lysine demethylase 2B (KDM2B), to the CDC25A promoter, which enhanced CDC25A expression through demethylation of H3k4me3. Overexpression of ALX3 in cells blocked the inhibitory effects of CDC25A silencing. CDC25A was found as a positive regulator of the PI3K/Akt signaling pathway.\nCONCLUSION: This study suggested that the ALX3 increased CDC25A expression through KDM2B-mediated demethylation of H3K4me3, which induced proliferation and cell cycle progression of cervical cancer cells.", "claims": [{"id": "claim-data-access", "statement": "All the data generated or analyzed during this study are included in this published article. The GSE63514 dataset is available at (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34266408", "locator": "sections[36] \"notes\" paragraph 1", "quote": "All the data generated or analyzed during this study are included in this published article. The GSE63514 dataset is available at (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34266408"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE63514"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE63514"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34266408", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12885-021-08552-7", "sha256": "sha256:9495004ca6e20669530a58d11052493d8217a6b1e8fd017a7174ed7d0636bf29", "bytes": 45943, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12885-021-08552-7", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8284019", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE63514", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE63514", "version": null, "note": "All the data generated or analyzed during this study are included in this published article. The GSE63514 dataset is available at (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All the data generated or analyzed during this study are included in this published article. The GSE63514 dataset is available at (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1551311", "GSM1551312", "GSM1551313", "GSM1551314", "GSM1551315", "GSM1551316", "GSM1551317", "GSM1551318", "GSM1551319", "GSM1551320", "GSM1551321", "GSM1551322", "GSM1551323", "GSM1551324", "GSM1551325", "GSM1551326", "GSM1551327", "GSM1551328", "GSM1551329", "GSM1551330", "GSM1551331", "GSM1551332", "GSM1551333", "GSM1551334", "GSM1551335", "GSM1551336", "GSM1551337", "GSM1551338", "GSM1551339", "GSM1551340", "GSM1551341", "GSM1551342", "GSM1551343", "GSM1551344", "GSM1551345", "GSM1551346", "GSM1551347", "GSM1551348", "GSM1551349", "GSM1551350", "GSM1551351", "GSM1551352", "GSM1551353", "GSM1551354", "GSM1551355", "GSM1551356", "GSM1551357", "GSM1551358", "GSM1551359", "GSM1551360", "GSM1551361", "GSM1551362", "GSM1551363", "GSM1551364", "GSM1551365", "GSM1551366", "GSM1551367", "GSM1551368", "GSM1551369", "GSM1551370", "GSM1551371", "GSM1551372", "GSM1551373", "GSM1551374", "GSM1551375", "GSM1551376", "GSM1551377", "GSM1551378", "GSM1551379", "GSM1551380", "GSM1551381", "GSM1551382", "GSM1551383", "GSM1551384", "GSM1551385", "GSM1551386", "GSM1551387", "GSM1551388", "GSM1551389", "GSM1551390", "GSM1551391", "GSM1551392", "GSM1551393", "GSM1551394", "GSM1551395", "GSM1551396", "GSM1551397", "GSM1551398", "GSM1551399", "GSM1551400", "GSM1551401", "GSM1551402", "GSM1551403", "GSM1551404", "GSM1551405", "GSM1551406", "GSM1551407", "GSM1551408", "GSM1551409", "GSM1551410", "GSM1551411", "GSM1551412", "GSM1551413", "GSM1551414", "GSM1551415", "GSM1551416", "GSM1551417", "GSM1551418", "GSM1551419", "GSM1551420", "GSM1551421", "GSM1551422", "GSM1551423", "GSM1551424", "GSM1551425", "GSM1551426", "GSM1551427", "GSM1551428", "GSM1551429", "GSM1551430", "GSM1551431", "GSM1551432", "GSM1551433", "GSM1551434", "GSM1551435", "GSM1551436", "GSM1551437", "GSM1551438"], "sample_count": 128, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene expression analysis of cervical cancer progression", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34266408:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f5b9fe557260e6356293be693a78f8c0337d6b738d1cf5c7b382f24ce58aa8b4", "bytes": 489, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[6]/table-wrap[1]#Tab1", "version": null, "note": "Primer sequences for RT-qPCR", "structure": {"pmcid": "PMC8284019", "section_index": 6, "section_title": "RT-qPCR", "row_count": 9, "column_count": 2}, "table": {"label": "Table 1", "caption": "Primer sequences for RT-qPCR", "rows": [["Gene", "Primer sequence (5′-3′)"], ["CDC25A", "F: TCTGGACAGCTCCTCTCGTCAT"], ["R: ACTTCCAGGTGGAGACTCCTCT"], ["ALX3", "F: GGAGAAGGTCTTCCAGAAAACCC"], ["R: ACTTGGCTCTGCGGTTCTGGAA"], ["KDM2B", "F: CATGGAGTGCTCCATCTGCAATG"], ["R: ACTTCGGACACTCCCAGCAGTT"], ["GAPDH", "F: GTCTCCTCTGACTTCAACAGCG"], ["R: ACCACCCTGTTGCTGTAGCCAA"]], "row_count": 9, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[6]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:34266408:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:75ec2e7f67160051c356dcef1aba190c7af453cce2f03e86f463d6e299bec0d5", "bytes": 1600, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[1]#Tab2", "version": null, "note": "DEGs in the GSE63514 dataset", "structure": {"pmcid": "PMC8284019", "section_index": 20, "section_title": "CDC25A is highly expressed in cervical cancer samples", "row_count": 25, "column_count": 6}, "table": {"label": "Table 2", "caption": "DEGs in the GSE63514 dataset", "rows": [["Gene Symbol", "logFC", "adj.p.Val", "Gene Symbol", "logFC", "adj.p.Val"], ["CDC25A", "3.41", "5.46E-33", "KIF14", "2.44", "2.76E-08"], ["CDC7", "2.44", "1.90E-12", "TTK", "2.07", "3.27E-08"], ["DTL", "2.88", "4.02E-12", "DDIAS", "2.64", "3.71E-08"], ["RMI2", "2.25", "5.17E-12", "HENMT1", "2.86", "4.81E-08"], ["CRISP2", "−4.18", "1.29E-11", "CRISP3", "−5.67", "1.14E-07"], ["UHRF1", "2.23", "1.29E-11", "C1orf112", "2.15", "1.31E-07"], ["CENPK", "2.39", "1.29E-11", "APOBEC3B", "2.31", "1.61E-07"], ["WDHD1", "2.34", "6.56E-11", "DNA2", "2.13", "2.74E-07"], ["ZNF367", "2.18", "1.14E-10", "SYNGR3", "3.44", "3.42E-07"], ["POLE2", "2.45", "5.03E-10", "KIF15", "2.39", "3.67E-07"], ["TIPIN", "2.12", "1.36E-09", "NUSAP1", "2.06", "4.16E-07"], ["CDKN2A", "2.68", "1.56E-09", "CTTNBP2", "−2.17", "5.04E-07"], ["TCAM1P", "3.83", "2.27E-09", "TOM1", "−2.02", "5.19E-07"], ["PHYHIP", "−3.2", "3.95E-09", "CTA-384D8.35", "2.89", "5.58E-07"], ["SPAG5", "2.4", "4.49E-09", "MLF1", "2.62", "9.82E-07"], ["C5orf34", "2.2", "5.79E-09", "CENPE", "2.5", "1.18E-06"], ["CENPQ", "2.24", "5.91E-09", "HS6ST2", "2.44", "1.23E-06"], ["HMMR", "2.13", "7.29E-09", "CCDC64B", "−2.19", "1.61E-06"], ["CDC6", "2.34", "7.64E-09", "SLC5A1", "−2.12", "1.65E-06"], ["NUF2", "2.25", "7.64E-09", "FAM86A", "−2.13", "1.73E-06"], ["KIF4A", "2.19", "1.28E-08", "APOC1", "2.31", "1.73E-06"], ["PRIM1", "2.5", "2.06E-08", "GGTLC1", "−2.05", "1.73E-06"], ["SYCP2", "2.2", "2.26E-08", "CITED4", "−2.63", "1.95E-06"], ["ACOX2", "−2.02", "2.54E-08", "EPB41L3", "−2.43", "2.29E-06"]], "row_count": 25, "column_count": 6, "numeric_cells": 106, "header_rows": 1, "locator": "section[20]/table-wrap[1]#Tab2"}}], "gaps": ["asset:data:geo:GSE63514 not downloaded", "asset:data:geo:GSE63514 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}, {"id": "method-2", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.8, "band": "high", "quote": "Limma"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE63514"], "resolved_accessions": ["GSE63514"], "statements": ["All the data generated or analyzed during this study are included in this published article. The GSE63514 dataset is available at (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514)."], "basis": "The paper names GSE63514 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:34266408", "data:geo:GSE63514", "asset:table:pmid:34266408:1", "asset:table:pmid:34266408:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE63514"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:41:40Z", "independence": "single_reader"}, "evidence_check": {"method": "absent", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 37377, "completion_tokens": 1928, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34266408", "type": "paper", "label": "pmid:34266408"}, {"id": "source:pmid:34266408", "type": "manuscript", "label": "PMID 34266408 full text"}, {"id": "data:geo:GSE63514", "type": "dataset", "label": "GEO GSE63514"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34266408", "type": "paper", "label": "pmid:34266408"}, {"id": "source:pmid:34266408", "type": "manuscript", "label": "PMID 34266408 full text"}, {"id": "data:geo:GSE63514", "type": "dataset", "label": "GEO GSE63514"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34266408", "type": "extraction", "used": ["source:pmid:34266408"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE63514", "type": "accession_resolution", "used": ["data:geo:GSE63514"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34266408", "parent_hash": "sha256:5dd94d54b665dc96b724385e3af0fd8cc852d6f110d18356c5b8c2ef03b3cdd7", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE63514 licence not read", "asset:data:geo:GSE63514 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["t in CSCC and normal cells was determined by RT-qPCR and western blot assays. Downregulation of C", "n CSCC and normal cells was determined by RT-qPCR and western blot assays. Downregulation of C", "ical epithelial cells (PCS480) determined by RT-qPCR and western blot analysis. Data were present", "l epithelial cells (PCS480) determined by RT-qPCR and western blot analysis. Data were present"], "order_basis": "paper_text_order:611", "id": "assay:1"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["d normal cells was determined by RT-qPCR and western blot assays. Downregulation of CDC25A was introdu", "ial cells (PCS480) determined by RT-qPCR and western blot analysis. Data were presented as the mean ±"], "order_basis": "paper_text_order:623", "id": "assay:2"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.69, "evidence": ["ell cycle progression, and it increased cell apoptosis. ALX3 was a positive regulator of CDC25A thr"], "order_basis": "paper_text_order:1115", "id": "assay:3"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["rt-sequence tandem repeat region. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) su", "ture CSCC cell lines (CaSki, ME180, C33A and Hela) and a primary cervix epithelial cell line (", "expression in CSCC cell lines (C33A, Caski, HeLa and ME180) and in PCS480 cells. Likewise, in", "n of CDC25A in CSCC cell lines (C33A, Caski, HeLa and ME180) and normal cervical epithelial ce"], "order_basis": "paper_text_order:1783", "id": "assay:4"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["analysis of variance"], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}