Genotypic Characteristics of Hepatoblastoma as Detected by Next Generation Sequencing and Their Correlation With Clinical Efficacy.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34426785", "kind": "science-record", "revision": 7, "content_hash": "sha256:ac06b8907d9b668e446c90593cedbf8cecc5b9336ee09f6450049412d8ac438b", "created_at": "2026-11-01T15:41:49Z", "updated_at": "2026-11-01T22:04:32Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Genotypic Characteristics of Hepatoblastoma as Detected by Next Generation Sequencing and Their Correlation With Clinical Efficacy.", "doi": "10.3389/fonc.2021.628531", "pmid": "34426785", "authors": ["Huimin Hu", "Weiling Zhang", "Tian Zhi", "Jing Li", "Yuan Wen", "Fan Li", "Yanyan Mei", "Dongsheng Huang"], "journal": "Frontiers in oncology", "year": 2021, "abstract": "BACKGROUND: Hepatoblastoma (HB) is the most common malignant embryonic liver tumor type in children under 3 years of age. In the present study, the next generation sequencing (NGS) method was used to detect the genotype characteristics of HB and summarize the correlation between the common mutation genotypes noted in this disease and the clinical treatment and prognosis. The results may aid clinical prognosis and the successful application of targeted drugs.\nMETHODS: Initially, DNA was extracted from tumor tissue specimens and peripheral blood derived from 19 pediatric patients with HB. Subsequently, DNA panel and NGS methods were used to detect tumor diagnosis and the expression levels of treatment-associated genes, followed by the summary of genotype characteristics. In addition, in order to further assess the application of immunotherapy in HB, immunohistochemical detection of programmed cell death 1 ligand 1 (PDL1) was performed in combination with tumor mutation burden (TMB) and DNA mismatch repair status analysis. Furthermore, the clinical treatment effect and prognosis of the pediatric patients were statistically analyzed according to the characteristics of the genotype. Overall prognosis and prognostic analyses in different groups were performed by Kaplan-Meier and log-rank tests, respectively. Finally, expression validation and diagnostic analysis of commonly reported genes were performed in the GSE75271 dataset, which was obtained from the Gene Expression Omnibus (GEO) database.\nRESULTS: In the present study, certain mutated genes, including nuclear factor erythroid 2-related factor 2 (NFE2L2), catenin β1 (CTNNB1), MYCN, tumor protein p53, axis inhibition protein 1 (AXIN1) and adenomatous polyposis coli (APC) were associated with the pathogenesis of HB. During TMB and DNA mismatch repair status analyses, pediatric patients had a low TMB. All of them did not present with microsatellite instability. The immunohistochemical results indicated lower expression levels of PDL1 in HB. The complete remission (CR) rate of pediatric patients in the gene abnormality group was lower than that of the non-reported disease-associated gene abnormality group. The 2-year overall survival rate and disease-free survival rate of 19 pediatric patients with HB were 72.1% and 42.4%, respectively. Receiver operating characteristic (ROC) analysis demonstrated that CTNNB1, NFE2L2, AXIN1, APC, MYCN and insulin growth factor 2 (IGF2) may be potential biomarkers that could be used for the diagnosis of HB.\nCONCLUSION: The genotype changes in HB were more common and the CR rate of the pediatric patients with an altered genotype was lower than that of pediatric patients without an altered genotype. In addition, pediatric patients with HB exhibited lower TMB compared with adult patients. Moreover, the data indicated that CTNNB1, NFE2L2, AXIN1, APC, MYCN and IGF2 may be potential biomarkers that can be used for the diagnosis of HB.", "claims": [{"id": "claim-data-access", "statement": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34426785", "locator": "sections[22] \"Data Availability Statement\" paragraph 2", "quote": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34426785"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE75271"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:group_comparison_wilcoxon", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE75271"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:group_comparison_wilcoxon"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34426785", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fonc.2021.628531", "sha256": "sha256:34af2dd697650fa54548a89478b5c576e531a47db1c44a251f694dfe32eaa5a6", "bytes": 44807, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fonc.2021.628531", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8379014", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE75271", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE75271", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE75271", "version": null, "note": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1948559", "GSM1948560", "GSM1948561", "GSM1948562", "GSM1948563", "GSM1948564", "GSM1948565", "GSM1948566", "GSM1948567", "GSM1948568", "GSM1948569", "GSM1948570", "GSM1948571", "GSM1948572", "GSM1948573", "GSM1948574", "GSM1948575", "GSM1948576", "GSM1948577", "GSM1948578", "GSM1948579", "GSM1948580", "GSM1948581", "GSM1948582", "GSM1948583", "GSM1948584", "GSM1948585", "GSM1948586", "GSM1948587", "GSM1948588", "GSM1948589", "GSM1948590", "GSM1948591", "GSM1948592", "GSM1948593", "GSM1948594", "GSM1948595", "GSM1948596", "GSM1948597", "GSM1948598", "GSM1948599", "GSM1948600", "GSM1948601", "GSM1948602", "GSM1948603", "GSM1948604", "GSM1948605", "GSM1948606", "GSM1948607", "GSM1948608", "GSM1948609", "GSM1948610", "GSM1948611", "GSM1948612", "GSM1948613"], "sample_count": 55, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "mRNA profiles of 50 HB tumors", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:PRJNA751247", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=PRJNA751247", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "PRJNA751247", "version": null, "note": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247.", "access_statement_kind": "data_availability_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": null, "resolution_checked_at": "2026-10-31T18:35:56Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34426785:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b0befce98f8bb33962af439cc0685490dde1aa9224a304b62474063bcb77c394", "bytes": 1532, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#T1", "version": null, "note": "Clinical features of 19 pediatric patients with HB.", "structure": {"pmcid": "PMC8379014", "section_index": 14, "section_title": "Clinical Features of 19 Pediatric Patients With HB", "row_count": 40, "column_count": 3}, "table": {"label": "Table 1", "caption": "Clinical features of 19 pediatric patients with HB.", "rows": [["Feature", "Number of cases", "Proportion (%)"], ["Initial symptom", "", ""], ["Abdominal mass and liver space are occupied", "9", "47.37%"], ["Abdominal pain and bloating", "9", "47.37%"], ["Fever, fatigue and wasting", "1", "5.26%"], ["AFP value at onset (ng/mL)", "", ""], ["726-2170000, median: 31877", "", ""], ["<100", "0", "0"], ["≥100", "19", "100%"], ["PRETEXT staging", "", ""], ["PRETEXT II", "5", "26.32%"], ["PRETEXT III", "11", "57.89%"], ["PRETEXT IV", "3", "15.79%"], ["Intrahepatic lesion at onset", "", ""], ["Single lesion", "13", "68.42%"], ["Many lesions", "6", "31.58%"], ["COG staging", "", ""], ["COG II", "4", "21.05%"], ["COG III", "6", "31.58%"], ["COG IV", "9", "47.37%"], ["Pulmonary metastatic disease", "7", "36.84%"], ["Single lung metastasis", "2", "10.53%"], ["Double lung metastasis", "5", "26.32%"], ["Other distant metastases", "", ""], ["Osseous metastasis", "1", "5.26%"], ["Brain metastases", "1", "5.26%"], ["Other high risk factors affecting prognosis", "", ""], ["V+", "2", "10.53%"], ["P+", "2", "10.53%"], ["E+", "2", "10.53%"], ["H+", "1", "5.26%"], ["N+", "2", "10.53%"], ["Pathological type", "", ""], ["Epithelium type", "12", "63.16%"], ["Fetal type", "2", "10.53%"], ["Embryonal", "1", "5.26%"], ["Fetal and embryonic mixed type", "7", "36.84%"], ["Giant beam type", "1", "5.26%"], ["Embryo and giant beam mixed type", "1", "5.26%"], ["Epithelium and lobus intermedius mixed type", "7", "36.84%"]], "row_count": 40, "column_count": 3, "numeric_cells": 63, "header_rows": 1, "locator": "section[14]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:34426785:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:bb230bdd1511bf6a43eb5674f6ad1f7c142828ad274052e8f8dc9d3049ff3c13", "bytes": 3991, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#T2", "version": null, "note": "Specific genotypes of 19 clinical pediatric patients with HB. HB, hepatoblastoma.", "structure": {"pmcid": "PMC8379014", "section_index": 15, "section_title": "Genotypic Characteristics of Next-Generation Sequencing", "row_count": 43, "column_count": 13}, "table": {"label": "Table 2", "caption": "Specific genotypes of 19 clinical pediatric patients with HB. HB, hepatoblastoma.", "rows": [["Medical record No", "Genetic changes associated with HB paroxysm", "Abundance / Amplification multiple", "Unknown genetic change", "Abundance / Amplification multiple", "MSI", "TMB", "PDL1", "Pathological type", "β-catenin", "Recurrence or metastasis", "Survival time", "Prognosis"], ["1", "NFE2L2 c.230A>G p.D77G", "48.30%", "KMT2D c.5467G>T p.G1823X", "11.70%", "MSS", "3.9", "<1%", "Epithelium and lobus intermedius mixed type", "Positive", "Metastasis", "9", "PR"], ["NUP210L c.4475G>A p.G1492E", "20.00%"], ["ARID1A c. 2714C>G p.A905G", "18.50%"], ["TRIM23 c.868G>T p.A290S", "16.80%"], ["PTPRB c.5432A>G p.K1811R", "11.90%"], ["AURKA amplification", "1.51"], ["2", "", "", "", "", "MSS", "0", "<1%", "Epithelium and lobus intermedius mixed type", "Positive", "Recurrence", "17", "CR"], ["3", "", "", "ARID1A", "37.20%", "MSS", "1.69", "1.00%", "Fetal and embryonic mixed type", "Positive", "Recurrence", "29", "CR"], ["c.4764-4770delT p.A1589fs"], ["4", "NFE2L2 c.92G>C p.G31A", "22.00%", "EP300 c.3244_3245delinsTT p.Q1082L", "48.70%", "MSS", "1.69", "<1%", "Fetal type", "Positive", "Recurrence", "21", "CR"], ["PARP1 c.2680G>T p.G894N", "29.00%"], ["5", "CTNNB1 c.101G>T p.G34V", "11.60%", "", "", "MSS", "3.18", "", "Epithelium and lobus intermedius mixed type", "Positive", "Recurrence", "23", "PR"], ["6", "", "", "", "", "MSS", "0", "", "Fetal and embryonic mixed type", "Positive", "No", "12", "CR"], ["7", "MYCN amplification", "1.5", "TCF7L2 c.1258C>T p.R420W", "26.00%", "MSS", "2.25", "1-2%", "Epithelium and lobus intermedius mixed type", "Focal positive", "Recurrence", "22", "Dead"], ["MED12 c.5382G>T p.Q1794H", "24.70%"], ["8", "", "", "USP9X c.1916C>T p.P639L", "37.90%", "MSS", "3.93", "2.00%", "Embryo and giant trabecular mixed type", "Positive", "Recurrence", "15", "PR"], ["NOTCH3 c.3991C>G p.P1331A", "10.20%"], ["9", "CTNNB1 c.1003A>C p.K335Q", "45.50%", "", "", "MSS", "1.69", "", "Fetal and embryonic mixed type", "Positive", "Recurrence", "30", "Dead"], ["10", "", "", "BCL6 c.959A>G p.N320S", "12.70%", "MSS", "2.25", "", "Fetal type", "Positive", "Metastasis", "21", "CR"], ["HIST1H3F c.148C>G p.R50G", "11.90%"], ["11", "CTNNB1 c.94G>A p.D32N", "23.00%", "INPP4A c.959A>G p.N320S", "14.80%", "MSS", "", "", "Fetal and embryonic mixed type", "Positive", "Recurrence or metastasis", "17", "PD"], ["TP53 c.743G>A p.R248Q", "47.30%", "RFWD2 c.173C>G p.S58W", "13.90%"], ["12", "CTNNB1 c.121A>G p.T41A", "27.50%", "", "", "MSS", "", "", "Fetal and embryonic mixed type", "Positive", "No", "20", "CR"], ["13", "AXIN1", "13.11%", "EPHA7 c.1909C>T p.R637C", "7.16%", "MSS", "22", "", "giant beam type", "Positive", "Recurrence after PD", "50", "Dead"], ["c.516_537del CATGAAGCAGCTGATCGATCCT p.I172Mfs*63", "NRAS c.182A>G p.Q61R", "6.26%"], ["14", "APC c.5465T>A p.V1822D", "11.20%", "PIK3C2B c.533C>T p.P178L", "36.50%", "MSS", "5", "0", "Fetal type", "Positive", "Recurrence or metastasis", "40", "PR"], ["IGF2", "31.61%"], ["c.517_538dup ACACCTGGAAGCAGTCCACC p.Q180Rfs*78", ""], ["NORCH1 c.1820G>T p.C607F", ""], ["DICER1", "28.96%"], ["c.4082A>G p.K1361R", ""], ["c.4064A>G p.N1355S", "25.40%"], ["", "25.06%"], ["15", "CTNNB1 c.53_241+117del306", "47.50%", "", "", "MSS", "0", "", "Epithelium and lobus intermedius mixed type", "negative", "PD", "25", "Dead"], ["16", "CTNNB1", "21.20%", "NUP93 c.180-2A>T", "41.40%", "MSS", "1.34", "1-2%", "Epithelium and lobus intermedius mixed type", "Positive", "Recurrence or metastasis", "24", "CR"], ["c.66_95del p.His24_Ser33del", "PREX2 c.2741C>G p.A914G", "38.30%"], ["", "PAK7 c.1573T>C p.F525L", "28.60%"], ["17", "", "", "ATRX c.2701C>G p.I901V", "8.14%", "MSS", "9", "", "Epithelium and lobus intermedius mixed type", "Positive", "Recurrence", "9", "CR"], ["PTCH1 c.2479A>G p.S827G", "5.60%"], ["MPL c.173C>T p.A58VG", "6.40%"], ["18", "CTNNB1 c.94G>A p.D32N", "14.14%", "", "", "MSS", "4.8", "", "Fetal and embryonic mixed type", "Positive", "Recurrence", "15", "CR"], ["19", "", "", "", "", "MSS", "1.11", "", "Fetal and embryonic mixed type", "Positive", "Recurrence", "23", "CR"]], "row_count": 43, "column_count": 13, "numeric_cells": 147, "header_rows": 1, "locator": "section[15]/table-wrap[1]#T2"}}], "gaps": ["asset:data:geo:GSE75271 not downloaded", "asset:data:geo:GSE75271 licence not read", "asset:data:geo:PRJNA751247 not downloaded", "asset:data:geo:PRJNA751247 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "wilcoxon", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["group_comparison_wilcoxon"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "reordered", "quote": "“Expression verification was performed using the Wilcoxon signed-rank test in order to analyze significant differences.” “Expression validation and diagnostic analyses of commonly reported genes were performed in the GSE75271 dataset (involving 50 HB samples and five normal controls), which was obtained from the Gene Expression Omnibus (GEO) database (19).”"}}, {"id": "method-2", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-3", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "log-rank"}}], "targets": [], "gaps": ["method.group_comparison_wilcoxon"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["group_comparison_wilcoxon"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: wilcoxon."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["PRJNA751247", "GSE75271"], "resolved_accessions": ["GSE75271"], "statements": ["The data presented in the study are deposited in the SRA repository, accession number PRJNA751247."], "basis": "The paper names GSE75271 in SRA repository and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:34426785", "data:geo:GSE75271", "asset:table:pmid:34426785:1", "asset:table:pmid:34426785:2"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "group_comparison_wilcoxon", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE75271"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:33:51Z", "independence": "single_reader"}, "evidence_check": {"method": "reordered", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 35961, "completion_tokens": 1022, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34426785", "type": "paper", "label": "pmid:34426785"}, {"id": "source:pmid:34426785", "type": "manuscript", "label": "PMID 34426785 full text"}, {"id": "data:geo:GSE75271", "type": "dataset", "label": "GEO GSE75271"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34426785", "type": "paper", "label": "pmid:34426785"}, {"id": "source:pmid:34426785", "type": "manuscript", "label": "PMID 34426785 full text"}, {"id": "data:geo:GSE75271", "type": "dataset", "label": "GEO GSE75271"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34426785", "type": "extraction", "used": ["source:pmid:34426785"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE75271", "type": "accession_resolution", "used": ["data:geo:GSE75271"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34426785", "parent_hash": "sha256:0340eb34e732ebea7f7bdf9adff255884a52c9dd9bc0a9d4384ab0917c68609d", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE75271 licence not read", "asset:data:geo:GSE75271 not downloaded", "asset:data:geo:PRJNA751247 licence not read", "asset:data:geo:PRJNA751247 not downloaded", "execution.not_run", "method.group_comparison_wilcoxon", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:group_comparison_wilcoxon"], "assays": [{"role": "data_generation", "definition_id": "amplicon_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["esent study, the next generation sequencing (NGS) method was used to detect the genotype char", "atients with HB. Subsequently, DNA panel and NGS methods were used to detect tumor diagnosis", "nstability (MSI) (17). In the present study, NGS method was used to evaluate the length distr"], "order_basis": "paper_text_order:263", "id": "assay:1"}, {"role": "data_generation", "definition_id": "ihc", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["sess the application of immunotherapy in HB, immunohistochemical detection of programmed cell death 1 ligand", "present with microsatellite instability. The immunohistochemical results indicated lower expression levels of"], "order_basis": "paper_text_order:947", "id": "assay:2"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["“Expression verification was performed using the Wilcoxon signed-rank test in order to analyze significant differences.” “Expression validation and diagnostic analyses of commonly reported genes were performed in the GSE75271 dataset (involving 50 HB samples and five normal controls), which was obtained from the Gene Expression Omnibus (GEO) database (19).”"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}