BCG immunotherapy inhibits cancer progression by promoting the M1 macrophage differentiation of THP‑1 cells via the Rb/E2F1 pathway in cervical carcinoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34581419", "kind": "science-record", "revision": 9, "content_hash": "sha256:8085da66239b525041b57d60bff4e3a368177e53c9605b269ac1dddc9f528079", "created_at": "2026-11-01T15:41:54Z", "updated_at": "2026-11-01T22:47:37Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "BCG immunotherapy inhibits cancer progression by promoting the M1 macrophage differentiation of THP‑1 cells via the Rb/E2F1 pathway in cervical carcinoma.", "doi": "10.3892/or.2021.8196", "pmid": "34581419", "authors": ["Limin Liu", "Wenjuan Shi", "Xiao Xiao", "Xuemei Wu", "Haiyan Hu", "Shixin Yuan", "Kai Liu", "Zhihua Liu"], "journal": "Oncology reports", "year": 2021, "abstract": "Bacillus Calmette‑Guérin (BCG) immunotherapy increases macrophage polarization toward M1‑type macrophages. In the present study, to identify the M1/M2 marker genes in the carcinogenesis and progression of cervical cancer, the microarray datasets GSE9750 and GSE7803 were downloaded from The Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO) and the University of California Santa Cruz (UCSC) Xena browser. Survival analysis revealed that M1 markers (IL‑12) were involved in anti‑tumour progression, and M2 markers (IL‑10) were involved in the carcinogenesis and invasion of cervical cancer. The expression of M1 markers (IL‑12, inducible nitric oxide synthase and CD80) and M2 markers (IL‑10 and arginase) was examined to determine whether BCG affects the polarization of macrophages and to elucidate the underlying mechanisms. The results revealed that BCG promoted macrophage polarization towards the M1 phenotype and enhanced the transition of M2 to M1 macrophages. The results also revealed that polarized M1 macrophages induced by BCG decreased the protein expression of phosphorylated (p‑)retinoblastoma (Rb)/E2F transcription factor 1 (E2F1), inhibited the proliferation and promoted the apoptosis of HeLa cells. On the whole, these results demonstrated that BCG promoted the anti‑tumour progression of M1 macrophages and inhibited the pro‑tumour activation of M2 macrophages via the Rb/E2F1 signalling pathway in HeLa cells. This suggests the possibility of a direct translation of this combination strategy to clinical practice for the treatment of cervical cancer.", "claims": [{"id": "claim-method", "statement": "The association between mRNA expression and overall survival (OS), or disease-free survival (DFS) was determined using the ‘Cox PH Model’ with the Kaplan-Meier survival plot. The survival curves of samples with high and low gene expression were compared using the log-rank test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34581419", "locator": "sections[5] \"Survival analysis\" paragraph 2", "quote": "The association between mRNA expression and overall survival (OS), or disease-free survival (DFS) was determined using the ‘Cox PH Model’ with the Kaplan-Meier survival plot. The survival curves of samples with high and low gene expression were compared using the log-rank test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34581419", "locator": "sections[4] \"Cervical cancer datasets and pre-processing\" paragraph 2", "quote": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34581419"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE7803"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE7803"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34581419", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3892/or.2021.8196", "sha256": "sha256:3b7806f6b99c11b369b64e40e564ef23d968c334ed983d849f11fefcfb2dd716", "bytes": 50842, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3892/or.2021.8196", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8493057", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE7803", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE7803", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE7803", "version": null, "note": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM189381", "GSM189382", "GSM189383", "GSM189384", "GSM189385", "GSM189386", "GSM189387", "GSM189388", "GSM189389", "GSM189390", "GSM189391", "GSM189392", "GSM189393", "GSM189394", "GSM189395", "GSM189396", "GSM189397", "GSM189398", "GSM189399", "GSM189400", "GSM189401", "GSM189402", "GSM189403", "GSM189404", "GSM189405", "GSM189406", "GSM189407", "GSM189408", "GSM189409", "GSM189410", "GSM189411", "GSM189412", "GSM189413", "GSM189414", "GSM189415", "GSM189416", "GSM189417", "GSM189418", "GSM189419", "GSM189420", "GSM189421"], "sample_count": 41, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Human pre-invasive and invasive cervical squamous cell carcinomas and normal cervical epithelia", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE9750", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE9750", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE9750", "version": null, "note": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM246087", "GSM246088", "GSM246089", "GSM246090", "GSM246119", "GSM246120", "GSM246121", "GSM246122", "GSM246123", "GSM246422", "GSM246423", "GSM246484", "GSM246485", "GSM246486", "GSM246487", "GSM246488", "GSM246489", "GSM246490", "GSM246491", "GSM247162", "GSM247163", "GSM247164", "GSM247165", "GSM247166", "GSM247168", "GSM247169", "GSM247171", "GSM247173", "GSM247174", "GSM247175", "GSM247188", "GSM247189", "GSM247190", "GSM247650", "GSM247651", "GSM247652", "GSM247653", "GSM247654", "GSM247655", "GSM247656", "GSM247657", "GSM247658", "GSM247659", "GSM247660", "GSM247661", "GSM247662", "GSM247663", "GSM247856", "GSM247857", "GSM247859", "GSM247860", "GSM247862", "GSM247864", "GSM247865", "GSM247866", "GSM247876", "GSM247877", "GSM247878", "GSM247879", "GSM247881", "GSM247882", "GSM247883", "GSM247884", "GSM247885", "GSM247886", "GSM247887"], "sample_count": 66, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Identification of gene expression profiles in cervical cancer ", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34581419:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5c9cb39bb335097d47971b0d0ed1fea04814d7f210e046349f08632ecef4ef79", "bytes": 666, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#tI-or-0-0-8196", "version": null, "note": "Primer sequences used for RT-qPCR.", "structure": {"pmcid": "PMC8493057", "section_index": 10, "section_title": "Reverse transcription-quantitative PCR (RT-qPCR)", "row_count": 10, "column_count": 2}, "table": {"label": "Table I.", "caption": "Primer sequences used for RT-qPCR.", "rows": [["IL-10", "Forward primer: CACTGCTCTGTTGCCTGGTC"], ["", "Reverse primer: GAAGCATGTTAGGCAGGTTGC"], ["IL-12", "Forward primer: GGACCTTGGACCAGAGCAGT"], ["", "Reverse primer: GGCTTAGAACCTCGCCTCCT"], ["ARG", "Forward primer: TTGGCTTGAGAGACGTGGAC"], ["", "Reverse primer: CCATCACCTTGCCAATTCCT"], ["iNOS", "Forward primer: GAGCCAGGCCACCTCTATGT"], ["", "Reverse primer: GTCCTCGACCTGCTCCTCAT"], ["GAPDH", "Forward primer: CGGAGTCAACGGATTTGGTCGTAT"], ["", "Reverse primer: AGCCTTCTCCATGGTGGTGAAGAC"]], "row_count": 10, "column_count": 2, "numeric_cells": 2, "header_rows": 0, "locator": "section[10]/table-wrap[1]#tI-or-0-0-8196"}}, {"id": "asset:table:pmid:34581419:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:208a2dbeed3a552a186052fd76454bccc851ca65c47c6dd1f48f33c8758e9b11", "bytes": 1066, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[18]/table-wrap[1]#tII-or-0-0-8196", "version": null, "note": "GO and KEGG pathway enrichment analysis of DEGs in GSE 7803/9750 CESC samples.", "structure": {"pmcid": "PMC8493057", "section_index": 18, "section_title": "Identification, KEGG and GO enrichment analyses of DEGs in GSE7803/9750", "row_count": 15, "column_count": 4}, "table": {"label": "Table II.", "caption": "GO and KEGG pathway enrichment analysis of DEGs in GSE 7803/9750 CESC samples.", "rows": [["Pathway ID", "Description", "Count in gene set", "P-value"], ["GO:0051301", "Cell division", "66", "<0.001"], ["GO:0006260", "DNA replication", "43", "<0.001"], ["GO:0000082", "G1/S transition of mitotic cell cycle", "31", "<0.001"], ["GO:0000086", "G2/M transition of mitotic cell cycle", "29", "<0.001"], ["GO:0008283", "Cell proliferation", "47", "<0.001"], ["GO:0007049", "Cell cycle", "26", "<0.001"], ["GO:1901796", "Regulation of signal transduction by p53", "18", "<0.001"], ["GO:0075733", "Intracellular transport of virus", "10", "<0.001"], ["GO:0006955", "Immune response", "34", "<0.01"], ["GO:0043066", "Negative regulation of apoptotic process", "36", "<0.01"], ["hsa04110", "Cell cycle", "34", "<0.001"], ["hsa03030", "DNA replication", "18", "<0.001"], ["hsa03420", "Nucleotide excision repair", "9", "<0.01"], ["hsa04115", "p53 signalling pathway", "10", "<0.05"]], "row_count": 15, "column_count": 4, "numeric_cells": 44, "header_rows": 1, "locator": "section[18]/table-wrap[1]#tII-or-0-0-8196"}}], "gaps": ["asset:data:geo:GSE7803 not downloaded", "asset:data:geo:GSE7803 licence not read", "asset:data:geo:GSE9750 not downloaded", "asset:data:geo:GSE9750 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The association between mRNA expression and overall survival (OS), or disease-free survival (DFS) was determined using the ‘Cox PH Model’ with the Kaplan-Meier survival plot. The survival curves of samples with high and low gene expression were compared using the log-rank test."}}, {"id": "method-2", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "Student's t-test"}}, {"id": "method-3", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}, {"id": "method-4", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "log-rank"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["survival_km"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: kaplan_meier."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE9750", "GSE7803"], "resolved_accessions": ["GSE9750", "GSE7803"], "statements": ["The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples."], "basis": "The paper names GSE9750, GSE7803 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["survival_km"], "assets": ["source:pmid:34581419", "data:geo:GSE7803", "asset:table:pmid:34581419:1", "asset:table:pmid:34581419:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE7803"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:50:40Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 28887, "completion_tokens": 2087, "cached_tokens": 520}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34581419", "type": "paper", "label": "pmid:34581419"}, {"id": "source:pmid:34581419", "type": "manuscript", "label": "PMID 34581419 full text"}, {"id": "data:geo:GSE7803", "type": "dataset", "label": "GEO GSE7803"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34581419", "type": "paper", "label": "pmid:34581419"}, {"id": "source:pmid:34581419", "type": "manuscript", "label": "PMID 34581419 full text"}, {"id": "data:geo:GSE7803", "type": "dataset", "label": "GEO GSE7803"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34581419", "type": "extraction", "used": ["source:pmid:34581419"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE7803", "type": "accession_resolution", "used": ["data:geo:GSE7803"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34581419", "parent_hash": "sha256:5c1877a9e4fd17ac9e253ee79cfaef83678e6724adb5b93af4aa5fef91f38041", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE7803 licence not read", "asset:data:geo:GSE7803 not downloaded", "asset:data:geo:GSE9750 licence not read", "asset:data:geo:GSE9750 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["esis and progression of cervical cancer, the microarray datasets GSE9750 and GSE7803 were downloaded"], "order_basis": "paper_text_order:336", "id": "assay:1"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.69, "evidence": ["inhibited the proliferation and promoted the apoptosis of HeLa cells. On the whole, these results d"], "order_basis": "paper_text_order:1313", "id": "assay:2"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["proliferation and promoted the apoptosis of HeLa cells. On the whole, these results demonstra", "phages via the Rb/E2F1 signalling pathway in HeLa cells. This suggests the possibility of a di", "humidified incubator with 5% CO2. Cells were cultured in Roswell Park Memorial Institute medium (RPMI"], "order_basis": "paper_text_order:1327", "id": "assay:3"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["survival_km"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The association between mRNA expression and overall survival (OS), or disease-free survival (DFS) was determined using the ‘Cox PH Model’ with the Kaplan-Meier survival plot. The survival curves of samples with high and low gene expression were compared using the log-rank test."], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}