HNF4A mitigates sepsis-associated lung injury by upregulating NCOR2/GR/STAB1 axis and promoting macrophage polarization towards M2 phenotype.

{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:39979267", "kind": "science-record", "revision": 2, "content_hash": "sha256:1873a34e2c19cf9458d0033665eef688ddf8b3f8cbed1717e6bc67ca002eaa51", "created_at": "2026-11-01T10:25:49Z", "updated_at": "2026-11-01T14:01:36Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "HNF4A mitigates sepsis-associated lung injury by upregulating NCOR2/GR/STAB1 axis and promoting macrophage polarization towards M2 phenotype.", "doi": "10.1038/s41419-025-07452-z", "pmid": "39979267", "authors": null, "journal": "Cell death & disease", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:39979267"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:39979267", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:39979267' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:39979267", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1038/s41419-025-07452-z", "sha256": "sha256:a5c03eff9dbfc62aa27bc60194ff12264cfc39ad59699c9fbcbc099d8d4ba592", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1038/s41419-025-07452-z", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:39979267:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c8aba1fd180d18bc6b20b40268dd328bec2345eccd5fc4aed97ad67bb2757b8a", "bytes": 663, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#Tab1", "version": null, "note": "primer sequences used in real-time PCR.", "structure": {"pmcid": "PMC11842871", "section_index": 15, "section_title": "Real-time PCR", "row_count": 3, "column_count": 3}, "table": {"label": "Table 1", "caption": "primer sequences used in real-time PCR.", "rows": [["primer", "Forward", "Reverse"], ["mus Arg-1mus CD163mus CD206mus HNF4Amus NCOA2", "TATCTGCCAAAGACATCGCAGCTTCGCTTGGTAGGGCAAGTGATTTGGAGGCTTGGTCGAGTGGGCCAAGTACTCATCCGTTCTCAGACTACTA", "ATCACCTTGCCAATCCCCACATTGGCATCAGTCATAATAGGAAACGGGAGAACCGTGCCGAGGGACGATGTAGATGCCCATTTGTTCCTTT"], ["mus Stab1mus iNOSmus MHCIImus GAPDH", "TGCTTCACTCCCTCAACTCACCACCCTCCTCGTTCCAGCCAAGATCAAAGTGCGTGTTCCTACCCCCAATGTGTCCGTC", "CCCAAGGCTAACTACACCCAATCCACAACTCGCTCCGCCAAGCCCGAGGAAGACTGGTCCTCAGTGTAGCCCAAGATG"]], "row_count": 3, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[15]/table-wrap[1]#Tab1"}}], "gaps": ["asset:source:pmid:39979267 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:39979267", "asset:table:pmid:39979267:1"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:39979267"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "full-text-reading-v1", "prompt_hash": "1cb8ab65f2ddf8684878368a3823eb67eb965bbdcb32cf71c1fd8d406dd46ff7", "source_hash": "a5c03eff9dbfc62aa27bc60194ff12264cfc39ad59699c9fbcbc099d8d4ba592", "raw_response_sha256": "sha256:0b2608b5d5232de35e63b090d6c23c7044d7320d72d982dfc1bd46243c78fcd0", "raw_response_chars": 3505}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "full-text-reading-v1", "prompt_hash": "6be38c3f825e1f7263531219fc05bc2ac44230e621605ea77a39cc29ddd22db3", "source_hash": "a5c03eff9dbfc62aa27bc60194ff12264cfc39ad59699c9fbcbc099d8d4ba592", "raw_response_sha256": "sha256:2960135d7c0921b3b17b917a7d8d62c02a2d0a1e2e3f760cc11c6d8312768429", "raw_response_chars": 50911}], "target_providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "replication-target-v2", "prompt_hash": "d1191e5a3dc2da54a9a615840070deca10f4af593eff7bba10e3cac853c1353a", "source_hash": "a5c03eff9dbfc62aa27bc60194ff12264cfc39ad59699c9fbcbc099d8d4ba592", "raw_response": "{\"parent_value\":0,\"unit\":\"\",\"evidence\":\"\",\"target_result\":\"The paper states that HNF4A overexpression resulted in a higher survival rate in septic mice and amelioration of pulmonary damage, but it does not state the numerical survival rate or another headline numerical result for the main finding.\",\"number_stated\":false}", "reading": {"parent_value": 0, "unit": "", "evidence": "", "target_result": "The paper states that HNF4A overexpression resulted in a higher survival rate in septic mice and amelioration of pulmonary damage, but it does not state the numerical survival rate or another headline numerical result for the main finding.", "number_stated": false, "source_locator": null}, "recorded_at": "2026-10-31T15:30:58.428773+00:00"}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "replication-target-v2", "prompt_hash": "251f9c4f4528b478c62cc4796af20bc8cbb182dd9f4e63d1704b49c6a04c0e3a", "source_hash": "a5c03eff9dbfc62aa27bc60194ff12264cfc39ad59699c9fbcbc099d8d4ba592", "raw_response": "<think>We need answer JSON only. Need determine source text contains headline numerical result for registered target? Source is abstract/methods snippets, no quantitative headline result except perhaps no survival rate numerical percentage, no main effect value. Need say number_stated false, parent_value 0, unit/evidence empty, target_result what text states instead. Need exact? Evidence empty due instruction if no number. target_result can summarize text states qualitative findings. Need not invent. JSON valid.\n\nQuestion nuanced: \"find the single numerical result that a replication of registered target has to reproduce. Report headline number only: value paper itself states for registered target\". The supplied text lacks headline numeric result. Could there be thresholds, 10 DEGs, but not headline main finding. So false.\n\nNeed make target_result perhaps \"The text states that HNF4A overexpression resulted in a higher survival rate in septic mice and amelioration of pulmonary damage...\" Maybe mention mechanistic axis. Since asks \"say in target_result what the text does state instead.\" Could use wording concise. Ensure no numerical claims? It says no number. We can state no numerical main-finding result; text reports qualitative outcomes. Evidence empty. Unit empty.\n\nNeed perhaps exact contiguous quote? Evidence only required exact quotation containing number; absent means empty. target_result likely prose. JSON with schema.</think>\n\n{\"parent_value\":0,\"unit\":\"\",\"evidence\":\"\",\"target_result\":\"No numerical value is stated for the main finding. The text reports that HNF4A overexpression resulted in a higher survival rate in septic mice, ameliorated pulmonary damage, reduced inflammatory-cell infiltration, impeded M1 polarization, and facilitated M2 polarization.\",\"number_stated\":false}", "reading": {"parent_value": 0, "unit": "", "evidence": "", "target_result": "No numerical value is stated for the main finding. The text reports that HNF4A overexpression resulted in a higher survival rate in septic mice, ameliorated pulmonary damage, reduced inflammatory-cell infiltration, impeded M1 polarization, and facilitated M2 polarization.", "number_stated": false, "source_locator": null}, "recorded_at": "2026-10-31T15:30:59.793594+00:00"}], "agreement": false, "disagreements": {"target_result": {"minimax": "HNF4A overexpression resulted in a higher survival rate in septic mice, although no numerical survival value was reported.", "minimax_alt": "unclear — the closest headline result stated is that \"HNF4A overexpression resulted in a higher survival rate in septic mice,\" but no numerical survival value or effect size is provided in the supplied text.", "decisive": false}, "physical_methods": {"minimax": ["Cecal ligation and puncture mouse sepsis model", "Adenoviral HNF4A overexpression in mice", "Western blot analysis", "Flow cytometer analysis of macrophage polarization", "Interleukin-4 treatment of bone marrow-derived macrophages"], "minimax_alt": ["Cecal ligation and puncture (CLP) mouse sepsis model", "Adenovirus-vector-mediated HNF4A overexpression injected into mice", "In vitro interleukin-4 treatment of bone marrow-derived macrophages", "Transcriptome sequencing (mRNA-seq)", "Western blot analysis", "Flow cytometry analysis"], "decisive": false}, "analysis_methods": {"minimax": ["Transcriptomic analysis of lung tissues", "Differential expressed gene analysis using ∣log2FoldChange∣> 1 and −log10 (p-value) > 2.5", "Gene Ontology enrichment analysis", "Venn diagram analysis", "Transcriptome sequencing analysis"], "minimax_alt": ["Transcriptomic differential-expression analysis of CLP and sham lung tissues (|log2FoldChange| > 1 and −log10(p-value) > 2.5)", "Gene Ontology enrichment analysis of biological process and molecular function terms", "Venn diagram overlap analysis", "Western-blot band optical-density quantification using Gel-Pro-Analyzer", "Flow-cytometric assessment of M1/M2 macrophage polarization", "Two-group comparisons using two-tailed unpaired Student t-tests", "Three-or-more-group comparisons using one-way ANOVA with post hoc Tukey's tests", "Survival-curve comparison using the log-rank test and Kaplan–Meier plotting"], "decisive": false}, "statistical_method": {"minimax": "log-rank test", "minimax_alt": "Log-rank test for the survival comparison; Kaplan–Meier method for plotting the survival curve.", "decisive": true}}, "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": []}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:0ac1f16e4cc6c0c62af99adcf55f5d4577e06674aa56e42284d55bb8e8656f98", "type": "sep_package", "label": "SEP v1 package for pmid:39979267"}], "activities": [{"id": "activity:conversion:pmid:39979267", "type": "conversion", "used": ["package:0ac1f16e4cc6c0c62af99adcf55f5d4577e06674aa56e42284d55bb8e8656f98"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:minimax", "type": "model", "label": "minimax"}, {"id": "agent:minimax_alt", "type": "model", "label": "minimax_alt"}, {"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:39979267", "parent_hash": "sha256:ac54179ed04682156e9f192bac66e8f748bc5a99689fa62131cb21794bf85504", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:39979267 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:39979267' does not resolve to a declared asset", "targets"]}