OTUD7B Stabilization by METTL14-Mediated m6A Methylation Drives HIF-1α Expression in Esophageal Squamous Cell Carcinoma.

{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:40746896", "kind": "science-record", "revision": 2, "content_hash": "sha256:e344e61aa59ed393615ca0db3a108b269fb9cfa01e982f31565f04a36ab4076a", "created_at": "2026-11-01T10:25:52Z", "updated_at": "2026-11-01T14:01:45Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "OTUD7B Stabilization by METTL14-Mediated m6A Methylation Drives HIF-1α Expression in Esophageal Squamous Cell Carcinoma.", "doi": "10.32604/or.2025.061301", "pmid": "40746896", "authors": null, "journal": "Oncology research", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:40746896"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:40746896", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40746896' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:40746896", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.32604/or.2025.061301", "sha256": "sha256:ec4cf1de586c034017d5401ceb43e796640eb8c163b662b00dd5a42d7a2884b6", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.32604/or.2025.061301", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:40746896:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a00bd21218e9bae088e8c588f13360cab760bc5fdafa446a19ea684399b4a18a", "bytes": 567, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#table-1", "version": null, "note": "Antibodies used for western blotting", "structure": {"pmcid": "PMC12308248", "section_index": 8, "section_title": "Western Blotting", "row_count": 7, "column_count": 4}, "table": {"label": "Table 1", "caption": "Antibodies used for western blotting", "rows": [["Antibody", "Manufacturer", "Cat. No.", "Dilution"], ["Anti-METTL14", "Abcam (Cambridge, MA, USA)", "ab309096", "1:1000"], ["Anti-OTUD7B", "ProSci (Poway, CA, USA)", "57-615", "1:1000"], ["Anti-β-actin", "Beyotime", "AF5003", "1:2000"], ["Anti-YTHDF1", "Beyotime", "AF8382", "1:1000"], ["Anti-HIF-1α", "Beyotime", "AG2135", "1:1000"], ["HRP-labeled Goat Anti-Rabbit IgG", "Beyotime", "A0208", "1:1000"]], "row_count": 7, "column_count": 4, "numeric_cells": 14, "header_rows": 1, "locator": "section[8]/table-wrap[1]#table-1"}}, {"id": "asset:table:pmid:40746896:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d1140054a45871123e20a74eb6f26fa36b36b79311399bd9508f518d7a1bc153", "bytes": 503, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#table-2", "version": null, "note": "Primers used for PCR", "structure": {"pmcid": "PMC12308248", "section_index": 9, "section_title": "RNA Extraction and RT-qPCR Analysis", "row_count": 7, "column_count": 3}, "table": {"label": "Table 2", "caption": "Primers used for PCR", "rows": [["Gene", "Sequence", ""], ["METTL14 (Homo sapiens)", "Forward", "CTGAAAGTGCCGACAGCATTGG"], ["", "Reverse", "CTCTCCTTCATCCAGATACTTACG"], ["β-actin (Homo sapiens)", "Forward", "CACCATTGGCAATGAGCGGTTC"], ["", "Reverse", "AGGTCTTTGCGGATGTCCACGT"], ["OTUD7B (Homo sapiens)", "Forward", "TCTCAGAGGCTGCTTCCTTTGG"], ["", "Reverse", "CGCCTTTTCAACGCTTCCTTCTC"]], "row_count": 7, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[9]/table-wrap[1]#table-2"}}], "gaps": ["asset:source:pmid:40746896 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:40746896", "asset:table:pmid:40746896:1", "asset:table:pmid:40746896:2"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:40746896"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "passed", "providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "full-text-reading-v1", "prompt_hash": "2f71756a7f592acc7ae5ff639ad788c83665fd891e2a517a00dcf59d7ef7afc8", "source_hash": "ec4cf1de586c034017d5401ceb43e796640eb8c163b662b00dd5a42d7a2884b6", "raw_response_sha256": "sha256:bf2722ac91091fe50b929753af0ff12d7b93eadad79e5f54bd661578a6bb298c", "raw_response_chars": 7016}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "full-text-reading-v1", "prompt_hash": "bf96a8bf0bca8ae5b5f8236eadad237cf41890a2334637dbd6258b891dcd5c9c", "source_hash": "ec4cf1de586c034017d5401ceb43e796640eb8c163b662b00dd5a42d7a2884b6", "raw_response_sha256": "sha256:32a5abb0aa07473474cac4bf9e5fae55f32be39c7516a7dac98a124388a0d2ad", "raw_response_chars": 39599}], "target_providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "replication-target-v2", "prompt_hash": "3de72f38172b8f70463f87e4fa7d432d240bbddd9f8f87625833e9f1acb1031a", "source_hash": "ec4cf1de586c034017d5401ceb43e796640eb8c163b662b00dd5a42d7a2884b6", "raw_response": "{\"parent_value\":0,\"unit\":\"\",\"evidence\":\"\",\"target_result\":\"The text states that METTL14 enhances OTUD7B mRNA stability and expression through m6A methylation, and that OTUD7B stabilizes HIF-1α by promoting deubiquitination, but it does not state a numerical result for this main finding.\",\"number_stated\":false}", "reading": {"parent_value": 0, "unit": "", "evidence": "", "target_result": "The text states that METTL14 enhances OTUD7B mRNA stability and expression through m6A methylation, and that OTUD7B stabilizes HIF-1α by promoting deubiquitination, but it does not state a numerical result for this main finding.", "number_stated": false, "source_locator": null}, "recorded_at": "2026-10-31T15:24:37.963112+00:00"}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "replication-target-v2", "prompt_hash": "a2d54080066234a44743298be5010cc0594e6109b4409486bef89be67cbe84aa", "source_hash": "ec4cf1de586c034017d5401ceb43e796640eb8c163b662b00dd5a42d7a2884b6", "raw_response": "<think>We need answer JSON only. Need carefully interpret task. Source text contains many numbers but headline numerical result for main finding? It seems no numeric headline result stated. Need assess. User registered target generic: \"the headline numerical result the paper states for its main finding\". Need find single numerical result paper states for main finding. Text abstract/results qualitative, no numeric experimental result. There are methods thresholds, dataset IDs, dates, sample counts, etc. We must not invent. Likely number_stated false, parent 0, unit \"\", evidence \"\", target_result explain no numerical headline result, only qualitative claims. Need exact JSON.\n\nNeed ensure perhaps headline number could be \"top 20 differentially m6A-modified genes\" but that's methods, not main finding. \"GSE179267\" not result. \"two m6A-enriched... one control\" methodology, not headline numerical result. Registered target asks main finding headline numerical. No number stated. Need set false. target_result what text does state instead. Could quote / summarize main finding: METTL14-mediated m6A methylation stabilizes OTUD7B, which promotes deubiquitination and stabilization of HIF-1α in ESCC. Need output exact source? target_result need no exact quote requirement except evidence. Since evidence empty. We can state no headline numerical result; the paper states qualitative main finding.\n\nNeed parent_value 0 numeric, unit \"\", evidence \"\". number_stated false. JSON no markdown. Ensure no hidden issue \"single numerical result\" perhaps study title no number. Main finding no number. Yes.\n\nLet's formulate target_result \"No headline numerical result is stated for the main finding; the paper instead states that METTL14-mediated m6A methylation stabilizes OTUD7B, thereby inhibiting the ubiquitin-proteasomal degradation of HIF-1α in ESCC.\" This is paraphrase but permissible target_result. Could exact quote instead: \"No numerical result is stated for the main finding. The text states: \\\"METTL14 plays a crucial role in the stabilization of OTUD7B through m6A methylation, thereby inhibiting the ubiquitin-proteasomal degradation of HIF-1α in ESCC.\\\"\" Fine. Need no evidence because no number. Answer only JSON.</think>\n\n{\"parent_value\":0,\"unit\":\"\",\"evidence\":\"\",\"target_result\":\"No headline numerical result is stated for the main finding. The paper instead states: \\\"METTL14 plays a crucial role in the stabilization of OTUD7B through m6A methylation, thereby inhibiting the ubiquitin-proteasomal degradation of HIF-1α in ESCC.\\\"\",\"number_stated\":false}", "reading": {"parent_value": 0, "unit": "", "evidence": "", "target_result": "No headline numerical result is stated for the main finding. The paper instead states: \"METTL14 plays a crucial role in the stabilization of OTUD7B through m6A methylation, thereby inhibiting the ubiquitin-proteasomal degradation of HIF-1α in ESCC.\"", "number_stated": false, "source_locator": null}, "recorded_at": "2026-10-31T15:24:44.900582+00:00"}], "agreement": true, "disagreements": {"target_result": {"minimax": "No headline numerical result is stated. The paper's main finding is qualitative: OTUD7B is identified as an m6A-driven oncogene correlated with METTL14 and HIF-1α, with METTL14 enhancing OTUD7B mRNA stability and expression through m6A methylation, while OTUD7B stabilizes HIF-1α by promoting deubiquitination.", "minimax_alt": "unknown", "decisive": false}, "physical_methods": {"minimax": ["dot blot assay", "gene-specific m6A-PCR", "clonogenic assay", "Transwell assay", "co-immunoprecipitation assay", "quantitative real-time PCR (qPCR) using SYBR Green master mix on a QX100 Droplet Digital PCR system", "comparative Ct (2−ΔΔCt) method"], "minimax_alt": ["dot blot assay", "Gene-specific m6A-PCR", "clonogenic assay", "Transwell assay", "co-immunoprecipitation assay", "quantitative real-time PCR (qPCR)"], "decisive": false}, "analysis_methods": {"minimax": ["differential gene expression analysis", "limma software suite in R (v3.5.1)", "Bayesian t-test statistics", "absolute log2 fold change ≥1 and false discovery rate-adjusted p-value < 0.05", "KEGG pathway analysis using R's ClusterProfiler toolkit", "expression-correlation analysis using the GEPIA platform", "SRAMP m6A site prediction"], "minimax_alt": ["differential gene expression analysis using the limma software suite in R (v3.5.1)", "Bayesian t-test statistics with thresholds of absolute log2 fold change ≥1 and false discovery rate-adjusted p-value < 0.05", "ggplot2 volcano plots and pheatmap clustered heatmaps", "SRAMP m6A site prediction", "KEGG pathway analysis using R’s ClusterProfiler toolkit", "GEPIA interactive expression profiling and expression-correlation assessment", "comparative Ct (2−ΔΔCt) method with GAPDH normalization"], "decisive": false}}, "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "passed", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": []}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.passed"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:e7367f4963367e2f83954f53a66090f768f9eda7cb56105ed81126a6c40d95cb", "type": "sep_package", "label": "SEP v1 package for pmid:40746896"}], "activities": [{"id": "activity:conversion:pmid:40746896", "type": "conversion", "used": ["package:e7367f4963367e2f83954f53a66090f768f9eda7cb56105ed81126a6c40d95cb"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:minimax", "type": "model", "label": "minimax"}, {"id": "agent:minimax_alt", "type": "model", "label": "minimax_alt"}, {"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:40746896", "parent_hash": "sha256:cddbad5ce6934159d95e5bd550a873f6d55e85c3d59933eb037d70f0aaf73d16", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:40746896 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.passed", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40746896' does not resolve to a declared asset", "targets"]}