mtDNA copy number/miR663/AATF axis in invasive ductal carcinoma of the breast.

{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:40922956", "kind": "science-record", "revision": 2, "content_hash": "sha256:2001b010f46396d763d9fd5cfb49c58f230cd2edf719925b2599ab01ada8f044", "created_at": "2026-11-01T10:25:53Z", "updated_at": "2026-11-01T14:01:47Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "mtDNA copy number/miR663/AATF axis in invasive ductal carcinoma of the breast.", "doi": "10.34172/bi.30792", "pmid": "40922956", "authors": null, "journal": "BioImpacts : BI", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "quantitative", "state": "complete", "target": {"value": 0.139, "unit": "fold change", "tolerance": null, "source": "chars 873-1019 of source sha256 3c9564175e5e0fd9adee4d2a0d6f4499ac66fc5b97d9c6f3b29ce0971f6de9e2"}, "evidence": [{"asset": "source:pmid:40922956", "locator": "chars 873-1019 of source sha256 3c9564175e5e0fd9adee4d2a0d6f4499ac66fc5b97d9c6f3b29ce0971f6de9e2", "quote": "A significant reduction in tumor miR663 expression was observed (fold change=0.139), with a strong correlation between miR663 and AATF expression."}]}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:40922956"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:40922956", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40922956' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:40922956", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.34172/bi.30792", "sha256": "sha256:3c9564175e5e0fd9adee4d2a0d6f4499ac66fc5b97d9c6f3b29ce0971f6de9e2", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.34172/bi.30792", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:40922956:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ad8d2f089ca3214b7f96b3340f20539ec9faf1cc4de74b4b62e9b2db7cd691a6", "bytes": 1154, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#T1", "version": null, "note": "Demographic information of the patients", "structure": {"pmcid": "PMC12413981", "section_index": 3, "section_title": "Patients and samples", "row_count": 30, "column_count": 3}, "table": {"label": "Table 1", "caption": "Demographic information of the patients", "rows": [["Characteristics", "Sub-groups", "Frequency (%)"], ["Histology grade", "Grade I (low-well differentiated)", "4 (18.2)"], ["Grade II (intermediate-moderately differentiated)", "12 (54.5)"], ["Grade III (high-poor differentiated)", "5 (22.7)"], ["Missing", "1 (4.5)"], ["Total", "22 (100)"], ["Site of primary tumor", "Left breast", "9 (40.9)"], ["Right breast", "12 (54.5)"], ["Bilateral", "1 (4.5)"], ["Total", "22 (100)"], ["Lymphatic invasion", "Positive", "13 (59.1)"], ["Negative", "8 (36.4)"], ["Missing", "1 (4.5)"], ["Total", "22 (100)"], ["Estrogen receptor", "Positive", "18 (81.8)"], ["Negative", "3 (13.6)"], ["Missing", "1 (4.5)"], ["Total", "22 (100)"], ["Progesterone receptor", "Positive", "15 (68.2)"], ["Negative", "6 (27.3)"], ["Missing", "1 (4.5)"], ["Total", "22 (100)"], ["Her-2", "Positive (1-2)", "4 (18.2)"], ["Positive (3 + )", "3 (13.6)"], ["Negative", "14 (63.6)"], ["Missing", "1 (4.5)"], ["Total", "22 (100)"], ["Family history", "Positive", "8 (36.3)"], ["Negative", "14 (63.6)"], ["Total", "22 (100)"]], "row_count": 30, "column_count": 3, "numeric_cells": 32, "header_rows": 0, "locator": "section[3]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:40922956:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c43bd8e443d6b1022e585fe8fb75bfb85ce4ca340c12b1ad6eb703238d6389d4", "bytes": 780, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#T2", "version": null, "note": "Primers and stem-loop sequences", "structure": {"pmcid": "PMC12413981", "section_index": 5, "section_title": "Total RNA extraction and cDNA synthesis", "row_count": 10, "column_count": 2}, "table": {"label": "Table 2", "caption": "Primers and stem-loop sequences", "rows": [["Primer", "Sequence (5'-3')"], ["MT-COX1", "Forward: TGATCTGCTGCAGTGCTCTGAReverse: TCAGGCCACCTACGGTGAA"], ["COX4", "Forward: GAAAGTGTTGTGAAGAGCGAAGACReverse: GTGGTCACGCCGATCCAT"], ["AATF", "Forward: TCGGTTTCATGTCCTTAGCAAGCReverse: GGAGGTGGGCGATGTCAATC"], ["PUM1", "Forward: TCGGAAGTAGCAGTTCTCTCGReverse: CTGTGTCCAATGGGGGTCAA"], ["miR663", "Forward: AGGCGGGGTGCTGCGGGA"], ["u47", "Forward: CCACTGCTGTAATGATTCTGC"], ["Universal reverse", "Reverse: CCAGTGCAGGGTCCGAGGTA"], ["miR663 Stem-loop", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCGGTC"], ["U47 Stem-loop", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCTCAG"]], "row_count": 10, "column_count": 2, "numeric_cells": 5, "header_rows": 0, "locator": "section[5]/table-wrap[1]#T2"}}], "gaps": ["asset:source:pmid:40922956 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:40922956", "asset:table:pmid:40922956:1", "asset:table:pmid:40922956:2"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:40922956"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "full-text-reading-v1", "prompt_hash": "b15bd51a4ec28ba2cd759fcf47b9618c5332869d3190f2c4698db513841f953f", "source_hash": "3c9564175e5e0fd9adee4d2a0d6f4499ac66fc5b97d9c6f3b29ce0971f6de9e2", "raw_response_sha256": "sha256:a8ef37bfa279085970bd3420816b2c8dd0df6e1092aa951712f0110d855f69b4", "raw_response_chars": 3557}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "full-text-reading-v1", "prompt_hash": "a401653c400ee603179f138db5dded98a14f6736ec900e8538622b6c0764e4d6", "source_hash": "3c9564175e5e0fd9adee4d2a0d6f4499ac66fc5b97d9c6f3b29ce0971f6de9e2", "raw_response_sha256": "sha256:8c1aca58c17931d19e674e895dcf3aad5de4d0dfd335612b9002822873cc6cce", "raw_response_chars": 64982}], "target_providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "replication-target-v2", "prompt_hash": "35963a54374fb1e0028da4876d9c637fa54e695c54c9410e39a965141b0d9151", "source_hash": "3c9564175e5e0fd9adee4d2a0d6f4499ac66fc5b97d9c6f3b29ce0971f6de9e2", "raw_response": "{\"parent_value\":0.139,\"unit\":\"fold change\",\"evidence\":\"A significant reduction in tumor miR663 expression was observed (fold change=0.139), with a strong correlation between miR663 and AATF expression.\",\"target_result\":\"The paper’s headline numerical result is a fold change of 0.139 for tumor miR663 expression.\",\"number_stated\":true}", "reading": {"parent_value": 0.139, "unit": "fold change", "evidence": "A significant reduction in tumor miR663 expression was observed (fold change=0.139), with a strong correlation between miR663 and AATF expression.", "target_result": "The paper’s headline numerical result is a fold change of 0.139 for tumor miR663 expression.", "number_stated": true, "source_locator": "chars 873-1019 of source sha256 3c9564175e5e0fd9adee4d2a0d6f4499ac66fc5b97d9c6f3b29ce0971f6de9e2"}, "recorded_at": "2026-10-31T15:34:21.418736+00:00"}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "replication-target-v2", "prompt_hash": "023a6c1233b31bddfa2c32a73cf39e8f3afb5942c97bb81249b1d3d9f39c020a", "source_hash": "3c9564175e5e0fd9adee4d2a0d6f4499ac66fc5b97d9c6f3b29ce0971f6de9e2", "raw_response": "<think>We need answer JSON only. Need identify single numerical result replication registered target headline numerical result paper states for main finding. Likely fold change = 0.139, unit maybe \"fold change\". Need exact contiguous quote containing number, whole clause for attribution. Need distinguish perhaps headline result main finding: significant reduction tumor miR663 expression fold change 0.139. The title mtDNA copy number/miR663/AATF axis. Abstract results specifically numerical headline. So parent_value 0.139, unit \"fold change\" (unit paper prints perhaps no physical unit). Evidence exact quote: \"A significant reduction in tumor miR663 expression was observed (fold change=0.139), with a strong correlation between miR663 and AATF expression.\" They insist exact contiguous quote and not shorten. This has number. Could quote more detailed sentence: \"The results demonstrated a significant decrease in miR663 expression in breast tumors compared to paired adjacent non-tumor tissues (fold change = 0.139, P = 0.000), as illustrated in Fig. 2A.\" It contains target attribution clearly. Unit should paper prints: fold change. Value number only 0.139. target_result perhaps \"The paper states a significant decrease in miR663 expression in breast tumors compared with paired adjacent non-tumor tissues, with a fold change of 0.139.\" Evidence exact quote. Number stated true.\n\nNeed consider \"headline numerical result the paper states for its main finding\" perhaps abstract's number. Single numerical result. The source has many numbers. Registered target broad. Likely expected 0.139 fold change. Need ensure unit perhaps \"\" because fold change is not unit? Prompt says unit must be unit paper prints. Paper prints \"(fold change=0.139)\" so unit \"fold change\" likely. Could unit be \"fold change\" rather than \"fold-change\". Use exact printed spelling in abstract: \"fold change=0.139\". Detailed section says \"fold change = 0.139\". Unit \"fold change\". JSON valid. Evidence exact contiguous quote, likely one sentence. target_result concise.\n\nLet's formulate no markdown.</think>\n\n{\"parent_value\":0.139,\"unit\":\"fold change\",\"evidence\":\"The results demonstrated a significant decrease in miR663 expression in breast tumors compared to paired adjacent non-tumor tissues (fold change = 0.139, P = 0.000), as illustrated in Fig. 2A.\",\"target_result\":\"miR663 expression was significantly decreased in breast tumors compared with paired adjacent non-tumor tissues, with a fold change of 0.139.\",\"number_stated\":true}", "reading": {"parent_value": 0.139, "unit": "fold change", "evidence": "The results demonstrated a significant decrease in miR663 expression in breast tumors compared to paired adjacent non-tumor tissues (fold change = 0.139, P = 0.000), as illustrated in Fig. 2A.", "target_result": "miR663 expression was significantly decreased in breast tumors compared with paired adjacent non-tumor tissues, with a fold change of 0.139.", "number_stated": true, "source_locator": "chars 4693-4885 of source sha256 3c9564175e5e0fd9adee4d2a0d6f4499ac66fc5b97d9c6f3b29ce0971f6de9e2"}, "recorded_at": "2026-10-31T15:34:23.175565+00:00"}], "agreement": false, "disagreements": {"target_result": {"minimax": "Significant reduction in tumor miR663 expression compared with paired adjacent non-tumor tissues (fold change = 0.139, P = 0.000).", "minimax_alt": "miR663 expression was significantly decreased in breast tumors compared with paired adjacent non-tumor tissues (fold change = 0.139, P = 0.000).", "decisive": false}, "physical_methods": {"minimax": ["Real-time PCR", "mtDNA copy number quantification using COX1 as the mitochondrial gene and COX4 as the nuclear control gene", "Relative gene-expression analysis using GraphPad Prism and REST software"], "minimax_alt": ["Real-time PCR", "Paired primary breast tumor and adjacent non-tumor tissue analysis", "miR663 relative-expression quantification normalized to U47", "AATF mRNA quantification using PUM1 as the internal control", "mtDNA copy-number quantification using COX1 as the mitochondrial gene and COX4 as the nuclear control gene"], "decisive": false}, "analysis_methods": {"minimax": ["2-ΔΔCt fold-change analysis", "Wilcoxon test", "Mann-Whitney U test", "Kruskal-Wallis test", "Spearman's Rank Correlation Coefficient", "TCGA in silico expression analysis"], "minimax_alt": ["2-ΔΔCt fold-change analysis", "Wilcoxon nonparametric test", "Mann-Whitney U test", "Kruskal-Wallis test", "Spearman's Rank Correlation Coefficient", "Z-score comparison between miR663 expression and mtDNA copy number", "In silico TCGA expression analysis across breast cancer stages and subtypes"], "decisive": false}, "statistical_method": {"minimax": "2-ΔΔCt fold-change method with nonparametric tests, including Wilcoxon, Mann-Whitney U, and Kruskal-Wallis tests", "minimax_alt": "Wilcoxon test for the paired miR663 tumor-versus-adjacent-tissue comparison; fold change calculated using the 2-ΔΔCt method.", "decisive": true}}, "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": []}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:770dad98162ccd13cd64521ed359608cb69d21548194134acc85b54897217e60", "type": "sep_package", "label": "SEP v1 package for pmid:40922956"}], "activities": [{"id": "activity:conversion:pmid:40922956", "type": "conversion", "used": ["package:770dad98162ccd13cd64521ed359608cb69d21548194134acc85b54897217e60"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:minimax", "type": "model", "label": "minimax"}, {"id": "agent:minimax_alt", "type": "model", "label": "minimax_alt"}, {"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:40922956", "parent_hash": "sha256:7f935309c898895a6ba9508f946d478b69a86a653f2fabeafcee7f726ff26c09", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:40922956 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40922956' does not resolve to a declared asset", "targets"]}